LFY, LFY (gene) Fragaria nubicola

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Fragaria nubicola
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487165.1-LFYFragaria nubicolagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487165.1-LFY.m1Fragaria nubicolamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYFragaria nubicolagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AF487165.1-LFY LG3:2705598..2706098
AF487165.1
mRNA parsed from NCBI nr database AF487165.1-LFY.m1 LG3:2705598..2706098
AF487165.1

Sequence(s):
>AF487165.1-LFY500
gtggcacgaggcaaaaagaacggactggattacctcttccatctctacgagcagtgccatcagtatttgacccaggtcca
gaacactgccaaggagcgtggtgaaaaatgtcccaccaaggtacgtacgtatggttaaaagttaaaaccgtacccatgat
attaatcctcttgtgcttttaatcattataatcagtagggaataactagaggtaaaagaccgtaaaactactattagctc
aaaaaaraattgttatgtgacttatgtcaatcatatcaatcgtagctgcagcagacccatactaatattacccagctgtt
cctctaaaaccatgacatttgcaactgacaccatcgaatcacattaataatttttattcattatttgaaagatgaaaatt
gaatttataaaactgattccttgcactatcaattttcgacgtacaggtgactaacgaggtgtttagatatgcgaaaaaac
aaggggccaactacatcaac
back to top
>AF487165.1-LFY.m1174
gtggcacgaggcaaaaagaacggactggattacctcttccatctctacgagcagtgccatcagtatttgacccaggtcca
gaacactgccaaggagcgtggtgaaaaatgtcccaccaaggtgactaacgaggtgtttagatatgcgaaaaaacaagggg
ccaactacatcaac
back to top