LFY, LFY (gene) Fragaria x ananassa

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Fragaria x ananassa
Synonym leafy-like protein
LEAFY
Description NA
Comment transcription factor
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYHQ222997.1-LFY.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HQ222997.1-LFY.m1 LG5:5849296..5850285
HQ222997.1

Sequence(s):
>HQ222997.1-LFY.m1364
gcacggactggattacctcttccatctgtacgagcagtgccatcagtttctgacccaggtgcagaacattgccaaggagc
gcggtgaaaaatgtcccaccaaggtcacaaaccaggtgtttagacatgcgaaagaggaaggagcgaactacatcaacaag
ccgaaaatgcggcactacgttcactgctacgcgctgcattgtctggacgaggagcgttcaattgcgctgaggcgtgagtg
caagctgcgaggagagaacatcggggcgtggaggcaggcatgctacaggcctgttgtggaaatagctgcaggccaaggtt
gggacattgacgccattttcagtgcacatcctcgactatctgtt
back to top