LFY, LFY (gene) Lyonothamnus floribundus

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Lyonothamnus floribundus
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487162.1-LFYLyonothamnus floribundusgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487162.1-LFY.m1Lyonothamnus floribundusmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYLyonothamnus floribundusgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AF487162.1-LFY N/A AF487162.1
mRNA parsed from NCBI nr database AF487162.1-LFY.m1 N/A AF487162.1

Sequence(s):
>AF487162.1-LFY659
gtggcacgtggcaaaaagaacggcctcgattacctcttccatctctacgagctgtgccgtgatttcttgatccaggtcca
gaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacggattatttacccacctcccttcatcatcacatacg
ctgatttctactgtggtaaacagtaaaaaataaccacaaaataatgagatcaataaactatgatgttagttagcaaaaaa
aaatacaattattataggcatgtgggcctagtattttagttggagaggcctgctgacagcatcaataactccgggccgga
tctaaatctatcattgggtatgaggcagagcaactgcacaagaaaaacaaaatcataactaggtttatgtcacaagatta
gtttttaatccagctttaatcttaatttgatttgactatagtcagatgtagatgtcgagttcaaccgcggattcgattac
gatgtaataactgttaatcaaatgcaaatgcgatgataatctgacccgatttaacaaaatgtagaattcattttccgttg
tactcagtgaaattgtggttaatgtagtgaacattgtgtatataggtgacaaaccaagtgtttaggcatgctaaaaaggc
aggcgcaagctacatcaac
back to top
>AF487162.1-LFY.m1174
gtggcacgtggcaaaaagaacggcctcgattacctcttccatctctacgagctgtgccgtgatttcttgatccaggtcca
gaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtgacaaaccaagtgtttaggcatgctaaaaaggcaggcg
caagctacatcaac
back to top