LFY, LFY (gene) Malus angustifolia

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Malus angustifolia
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500513.1-LFYMalus angustifoliagene
LFYEF127079.1-LFYMalus angustifoliagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500513.1-LFY.m1Malus angustifoliamRNA
LFYEF127079.1-LFY.m1Malus angustifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYMalus angustifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU500513.1-LFY N/A EU500513.1
gene parsed from NCBI nr database EF127079.1-LFY N/A EF127079.1
mRNA parsed from NCBI nr database EU500513.1-LFY.m1 N/A EU500513.1
mRNA parsed from NCBI nr database EF127079.1-LFY.m1 N/A EF127079.1

Sequence(s):
>EU500513.1-LFY1213
gaagcagccgtgccgccagcagccacagccgctggggcagcggctggttatacgttgcggccgccaggagagcttggact
tggagggcttgaagacttgttccaggcttatggggtcagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccctatctctggtgataccaccaccaatgccttagatgctctctcccaagaaggtactatacgctatatacatgaat
attatttaaggaaaactaatgaaaagggtttgaaaactttgagtttaaacgatanggacaaaataaagagtaaagtgaat
agtaccaggtttgactttttagtgtaaaatgtggtttttcgttnaaatgaacagtattgcgaacttttcattaaaactct
ctattatttaacctttgtgtcttaaattaaccgtagtatataggcatataggtagggtttgatcacactttgaaataaca
ttattttacatgtaaattaatagtgtgacaatataacatgttcaaatagatgattaaaaaaatttaggatttagtgaatc
aaagaagaaaaataggtcgcgaaacattaaaacttttggcctttggtgtaataatttgatggaaataacaaatcaaagat
gttttattttgcaacatagtatgccagatcatatgaggttcgagattgcgtgataaaactaaaagcatatgttttatatg
agtgtaacataatatgtcaattatcatagtctttgatgctagaacataaattagttgttatattagattgggatatatga
tacgatgtgcatgggatgtgtagggctgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtaggga
tggcgtggggggttgtgacggcgggggacaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagt
gctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacgacttgaatgggcaggg
gaacggtggtgga
back to top
>EF127079.1-LFY686
atggtgacggagccgggggaggtggcgcgtggcaaaaagaatggcctcgattacctcttccatctctacgagcagtgccg
cgatttcttgatccaggtccagaacatcgccaaggagcgcggtgaaaaatgtcccaccaaggtaccacgttttacccatc
tcccttttacttttacgtacgctgatttctactgtagaaactaacagtaacttcatcgtgttagccattgatttgtgggc
ccatttcctgtagtacaattaaaggctagtaggccgtaataaatttcaccacaaatctatatcttttaatcgaactcaac
ataaatattaaattgaggggtgtcctcgaattggaacaatttgcaatctacatgaactaaattagatgaaattaaacgca
ggtctttgtgaaaactacatggattaaaaacgtgtttcgggtgaatagctcagtatttagtccaaatttgattctactag
tgatttgagtccgttgattcgattatgatgtaatcaaatacgtgttaagaaaaaatgtacgccattataatctgaccgga
tttaacaaaatgtataatttcgtttgcatttgtttactctacacattatatatgcaggtgacaaaccaagtgtttaggta
tgccaaaaaggcaggggcaagctacatcaacaagccaaagatgcga
back to top
>EU500513.1-LFY.m1588
gaagcagccgtgccgccagcagccacagccgctggggcagcggctggttatacgttgcggccgccaggagagcttggact
tggagggcttgaagacttgttccaggcttatggggtcagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccctatctctggtgataccaccaccaatgccttagatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtggggggttgtgacggcgggggacaggcggaagaagcagcggaggatgaagaaggggcaa
tataggaactgtagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacga
cttgaatgggcaggggaacggtggtgga
back to top
>EF127079.1-LFY.m1210
atggtgacggagccgggggaggtggcgcgtggcaaaaagaatggcctcgattacctcttccatctctacgagcagtgccg
cgatttcttgatccaggtccagaacatcgccaaggagcgcggtgaaaaatgtcccaccaaggtgacaaaccaagtgttta
ggtatgccaaaaaggcaggggcaagctacatcaacaagccaaagatgcga
back to top