LFY, LFY (gene) Malus x domestica

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Malus x domestica
Synonym LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYGU991522.1-LFY.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly GU991522.1-LFY.m1 Chr14:23941067..23941480
chr14:20092740..20093153
chr14:23623912..23624325
GU991522.1

Sequence(s):
>GU991522.1-LFY.m1413
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggaggaggggcggcgtgggaggttgcgacggcaggg
gagaggcgtaaaaagcagcggaggatgaagaaggggcaatttagaaattgtagtgctggagggcgtcctaataatgataa
taacgagggtgtggacgacgaggacgacaacgacatggacgacatgactgggcacgggaacggtggaggagggggaatgc
tgggagagagacagagggagcacccgttcattgtgacggagcctggggaggtggcgcgtggcaaaaagaacggcctcgat
tacctcttccatctctacgagcagtgccgcgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatg
tcccaccaaggta
back to top