LFY, LFY (gene) Mespilus germanica

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Mespilus germanica
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500491.1-LFYMespilus germanicagene
LFYEU500490.1-LFYMespilus germanicagene
LFYEF127077.1-LFYMespilus germanicagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500491.1-LFY.m1Mespilus germanicamRNA
LFYEU500490.1-LFY.m1Mespilus germanicamRNA
LFYEF127077.1-LFY.m1Mespilus germanicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYMespilus germanicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU500491.1-LFY N/A EU500491.1
gene parsed from NCBI nr database EU500490.1-LFY N/A EU500490.1
gene parsed from NCBI nr database EF127077.1-LFY N/A EF127077.1
mRNA parsed from NCBI nr database EU500491.1-LFY.m1 N/A EU500491.1
mRNA parsed from NCBI nr database EU500490.1-LFY.m1 N/A EU500490.1
mRNA parsed from NCBI nr database EF127077.1-LFY.m1 N/A EF127077.1

Sequence(s):
>EU500491.1-LFY689
gaagcagccgtaacgccagcagcggcggctggttatacttttcggccgccaagagagcttggacttggagggcttgaaga
cttgttccaggcttatggggtcagatactacacggcggcgaagatagcggagcttggatttactgtgaacaccctcttgg
acatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttgcttgttggggagagg
tatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcgcaaccttgtctctgg
tgataccaccaccaatgccctagatgctctctcccaagaaggtactatacgctatatacatgaatattatatactacaac
ataaagtagtttgttatattagattgggatatatgatacgcggtgcatgggatgtgtagggctgtcagaggagccagtgc
aacaagagaaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcag
cggaggatgaagaaggggcaatataggaactgtagtgctggagggggtcataacaatgatcataacgagggtgtagacga
caaggacgacgacatggacgacatgaatgggcaggggaacggtggagga
back to top
>EU500490.1-LFY689
gaagcagccgtaacgccagcagcggcggctggttatacttttcggccgccaagagagcttggacttttagggcttgaaga
cttgttccaggcttatggggtcagatactacacggcggcgaagatagcggagcttggatttactgtgaacaccctcttgg
acatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttgcttgttggggagagg
tatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcgcaaccttgtctctgg
tgataccaccaccaatgccctaaatgctctctcccaagaaggtactatacgctatatacatgaatattatatactagaac
ataaagtagtttgttatattagattgggatatatgatacgcggtgcatgggatgtgtagggctgtcagaggagccagtgc
aacaagagaaggacatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcag
cggaggatgaagaaggggcaatataggaactgtagtgctggagggggtcataacaatgatcataacgagggtgtagacga
caaggacgacgacatggacgacatgaatgggcaggggaacggtggagga
back to top
>EF127077.1-LFY397
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagttttacccatc
tcccctcttacgtacgctgatttctactgtggcaattaattaacagtaaaaattctaatattaaatggtcgcgtttgtaa
tggttttagttctatagtttccacatagttatggtttcgttcacgtattgcaagtcgcatttgtttactcattacattat
atatgcaggtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatcaacaagcccaaaatgcgc
back to top
>EU500491.1-LFY.m1573
gaagcagccgtaacgccagcagcggcggctggttatacttttcggccgccaagagagcttggacttggagggcttgaaga
cttgttccaggcttatggggtcagatactacacggcggcgaagatagcggagcttggatttactgtgaacaccctcttgg
acatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttgcttgttggggagagg
tatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcgcaaccttgtctctgg
tgataccaccaccaatgccctagatgctctctcccaagaagtgcaacaagagaaggagatggtggggagcggagtaggga
tggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagt
gctggagggggtcataacaatgatcataacgagggtgtagacgacaaggacgacgacatggacgacatgaatgggcaggg
gaacggtggagga
back to top
>EU500490.1-LFY.m1573
gaagcagccgtaacgccagcagcggcggctggttatacttttcggccgccaagagagcttggacttttagggcttgaaga
cttgttccaggcttatggggtcagatactacacggcggcgaagatagcggagcttggatttactgtgaacaccctcttgg
acatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttgcttgttggggagagg
tatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcgcaaccttgtctctgg
tgataccaccaccaatgccctaaatgctctctcccaagaagtgcaacaagagaaggacatggtggggagcggagtaggga
tggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagt
gctggagggggtcataacaatgatcataacgagggtgtagacgacaaggacgacgacatggacgacatgaatgggcaggg
gaacggtggagga
back to top
>EF127077.1-LFY.m1210
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtgacaaaccaagtgttta
ggtatgccaaaaaggcaggggcaagctacatcaacaagcccaaaatgcgc
back to top