LFY, LFY (gene) Neillia incisa

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Neillia incisa
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487199.1-LFYNeillia incisagene
LFYAF487198.1-LFYNeillia incisagene
LFYAF487197.1-LFYNeillia incisagene
LFYAF487160.1-LFYNeillia incisagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487199.1-LFY.m1Neillia incisamRNA
LFYAF487198.1-LFY.m1Neillia incisamRNA
LFYAF487197.1-LFY.m1Neillia incisamRNA
LFYAF487160.1-LFY.m1Neillia incisamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYNeillia incisagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AF487199.1-LFY N/A AF487199.1
gene parsed from NCBI nr database AF487198.1-LFY N/A AF487198.1
gene parsed from NCBI nr database AF487197.1-LFY N/A AF487197.1
gene parsed from NCBI nr database AF487160.1-LFY N/A AF487160.1
mRNA parsed from NCBI nr database AF487199.1-LFY.m1 N/A AF487199.1
mRNA parsed from NCBI nr database AF487198.1-LFY.m1 N/A AF487198.1
mRNA parsed from NCBI nr database AF487197.1-LFY.m1 N/A AF487197.1
mRNA parsed from NCBI nr database AF487160.1-LFY.m1 N/A AF487160.1

Sequence(s):
>AF487199.1-LFY650
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacgctaatttctaccgtggtaaa
tacttmgtcatttacaacctgatcgttgtgggcccatcgttggctagtggcccgcaattggagaggcatgctgacacgtt
caatataaatgttcgaactaaatctaggaataattaatagtttgttactaaattaggaactttgggttcatttgggatta
cttctatagaaacacttttattaaaagcacaacaaaaaggaagtgcatctccaacaaccataaaaaatacttttagagta
maaaatcacttttaattatttcaaccatgggtcaagaccaaatgttgatccactaataattaatcgtgttcttctctttc
atagtaaaaaacacttgcactattttgtaggataaaaatctagacccaattgttggtgmagacgacttctattgtgtacg
gtgaatgttttatgttttcttctataatttgaaatgttttttgttttttttttctaacattaacaactgtcgtaagtact
aattgtgcattatgtataattggacggattaagcagcttacttattatatatgcaggtgacaaaccaggtgtttaggtat
gccaaaaagg
back to top
>AF487198.1-LFY648
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacgctaatttctaccgtggtaaa
tacttcgtcatttacaacctgatcgttgtgggcccatcgttggctagtggcccgcaattggagaggcatgctgacacgtt
caatataaatgttcgaactaaatctaggaataattaatagtttgttactaaattaggaactttgggttcatttgggatta
cttctatagaaacacttttattaaaagcacaacaaaaaggaagtgcatctccaacaaccataaaaaatacttttagagta
aaaaatcacttttaattatttcaaccatgggtcaagaccaaatgttgatccactaaattaatcgtgttcttctctttcat
agtaaaaaacacttgcactattttgtaggataaaaatctagacccaattgttggtgcagacgacttctattgtgtacggt
gaatgttttatgttttcttctataatttgaaatgttttttgttttttttttctaacattaacaactgtcgtaagtactaa
ttgtgcattatgtataattggacggattaagcagcttacttattatatatgcaggtgacaaaccaggtgtttaggtatgc
caaaaagg
back to top
>AF487197.1-LFY650
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacgctaatttctaccgtggtaaa
tacttcgtcatttacaacctgatcgttgtgggcccatcgttggctagtggcccgcaattggagaggcatgctgacacgtt
caatataaatgttcgaactaaatctaggaataattaatagtttgttactaaattaggaactttgggttcatttgggatta
cttctatagaaacacttttattaaaagcacaacaaaaaggaagtgcatctccaacaaccataaaaaatacttttagagta
caaaatcacttttaattatttcaaccatgggtcaagaccaaatgttgatccactaataattaatcgtgttcttctctttc
atagtaaaaaacacttgcactattttgtaggataaaaatctagacccaattgttggtgcagacgacttctattgtgtacg
gtgaatgttttatgttttcttctataatttgaaatgttttttgttttttttttctaacattaacaactgtcgtaagtact
aattgtgcattatgtataattggacggattaagcagcttacttattatatatgcaggtgacaaaccaggtgtttaggtat
gccaaaaagg
back to top
>AF487160.1-LFY767
gtggcacgtggcaaaaagaatggcctcgattacctcttccatctctacgagcagtgccgtgatttcttgatccaggtcca
gaacattgccaaggagcgcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacgcta
atttctaccgtggtaaatacttcgtcatttacaacctgatcgttgtgggcccatcgttggctagtggcccgcaattggag
aggcatgctgacacgttcaatataaatgttcgaactaaatctaggaataattaatagtttgttactaaattaggaacttt
gggttcatttgggattacttctatagaaacacttttattaaaagcacaacaaaaaggaagtgcatctccaacaaccataa
aaaatacttttagagtacaaaatcacttttaattatttcaaccatgggtcaagaccaaatgttgatccactaataattaa
tcgtgttcttctctttcatagtaaaaaacacttgcactattttgtaggataaaaatctagacccaattgttggtgcagac
gacttctattgtgtacggtgaatgttttatgttttcttctataatttgaaatgttttttgttttttttttctaacattaa
caactgtcgtaagtactaattgtgcattatgtataattggacggattaagcagcttacttattatatatgcaggtgacaa
accaggtgtttaggtatgccaaaaaggcaggggcaagctacatcaac
back to top
>AF487199.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487198.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487197.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487160.1-LFY.m1174
gtggcacgtggcaaaaagaatggcctcgattacctcttccatctctacgagcagtgccgtgatttcttgatccaggtcca
gaacattgccaaggagcgcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaaggcagggg
caagctacatcaac
back to top