LFY, LFY (gene) Neillia sinensis

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Neillia sinensis
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487180.1-LFYNeillia sinensisgene
LFYAF487179.1-LFYNeillia sinensisgene
LFYAF487178.1-LFYNeillia sinensisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487180.1-LFY.m1Neillia sinensismRNA
LFYAF487179.1-LFY.m1Neillia sinensismRNA
LFYAF487178.1-LFY.m1Neillia sinensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYNeillia sinensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AF487180.1-LFY N/A AF487180.1
gene parsed from NCBI nr database AF487179.1-LFY N/A AF487179.1
gene parsed from NCBI nr database AF487178.1-LFY N/A AF487178.1
mRNA parsed from NCBI nr database AF487180.1-LFY.m1 N/A AF487180.1
mRNA parsed from NCBI nr database AF487179.1-LFY.m1 N/A AF487179.1
mRNA parsed from NCBI nr database AF487178.1-LFY.m1 N/A AF487178.1

Sequence(s):
>AF487180.1-LFY671
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaatgctaatttctaccgtggtaaa
tactttgtcatttacaacctgatcgttgtgggcccatcgttggctagtgggccgcaattggagaggcattctgacacctt
caatataaatgttcgaactaaatctaggagcccaagttcacaagaaataaaatcattaatagtttggtactaaattagga
actttgggttcgtttgggattacttttatcgaaaacacttttattaaaagcacaacaaaaaggaagtgtgtctccaacaa
ccataaaaaatacttttagagtacaaaatcacttttaattatttcaaccatgggtcaagaccaaatgactcactaataat
taatcgtgttcttctctttcatagaaaaaaacacttgcactattttgtaggataaaaatctagacccaattgttggtgca
gacgacttctattgtgtacgataggtgaatgttttatgttttcttctataatttgaaatgttttttttttctttctaaca
ttaacaactgtcgtaagtactaattgtgcattatatataattggacggattaagcagcttacctattatatatgcaggtg
acaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487179.1-LFY671
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaatgctaatttctaccgtggtaaa
tactttgtcatttacaacctgatcgttgtgggcccatcgttggctagtgggccgcaattggagaggcattctgacacctt
caatataaatgttcgaactaaatctaggagcccaagttcacaagaaataaaatcattaatagtttggtactaaattagga
actttgggttcgtttgggattacttttatcgaaaacacttttattaaaagcacaacaaaaaggaagtgtgtctccaacaa
ccataaaaaatacttttagagtacaaaatcacttttaattatttcaaccatgggtcaagaccaaatgactcactaataat
taatcgtgttcttctctttcatagaaaaaaacacttgcactattttgtaggataaaaatctagacccaattgttggtgca
gacgacttctattgtgtacgataggtgaatgttttatgttttcttctataatttgaaatgttttttttttctttctaaca
ttaacaactgtcgtaagtactaattgtgcattatatataattggacggattaagcagcttacctattatatatgcaggtg
acaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487178.1-LFY670
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacgctaatttctaccgtggtaaa
tactttgtcatttacaacctgatcgttgtgggcccatcgttggctagtgggccgcaattggagaggcattctgacacctt
caatataaatgttcgaactaaatctaggagcccaagttcacgagaaataaaatcattaatagtttggtactaaattagga
actttgggttcgtttgggattacttttatcgaaaacacttttattaaaagcacaacaaaaaggaagtctgtctccaacaa
ccataaaaaatacttttagagtacaaaatcacttttaattatttcaaccatgggtcaagaccaaatgactcactaataat
taatcgtgttcttctctttcatagaaaaaaaacacttgcactattttgtaggataaaaatctagacccaattgttggtgc
agacgacttctattgtgtacgataggtgaatgttttatgttttcttctataatttgaaatgttttttttttttctaacat
taacaactgtcgtaagtactaattgtgcattatatataattggacggattaagcagcttacctattatatatgcaggtga
caaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487180.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487179.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487178.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top