LFY, LFY (gene) Neillia tanakae

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Neillia tanakae
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487201.1-LFYNeillia tanakaegene
LFYAF487200.1-LFYNeillia tanakaegene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487201.1-LFY.m1Neillia tanakaemRNA
LFYAF487200.1-LFY.m1Neillia tanakaemRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYNeillia tanakaegene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AF487201.1-LFY N/A AF487201.1
gene parsed from NCBI nr database AF487200.1-LFY N/A AF487200.1
mRNA parsed from NCBI nr database AF487201.1-LFY.m1 N/A AF487201.1
mRNA parsed from NCBI nr database AF487200.1-LFY.m1 N/A AF487200.1

Sequence(s):
>AF487201.1-LFY667
gcggtgagaaatgtcccaccaaggtacggagttacacccgtccctacgtttttacaaacgctaatttctaccgtggtaaa
tacttcgtcatttacaacctgatcgttgtggacccatcgttggctagtgggccgcaattggagaggcatgctgacacgtt
caatataaatgttcgaactaaatctaggagcccaagttcacaagaaataaaatcattaatagtttgttactaaattagga
acttagggttcgtttgggattatttctataggaacacttttattaaaagcacaacaaaaaggaagtgcatctccaacaac
cataaaaaatacttttagagtacaaaatcacttttaattatttcaaccgtgggtaaagaccaaatgttgacccactaata
attaatcagtcttcttctctttcatagttaaaaacacttgcactattttgtaggataaaaatctagacccaattgttggt
gcagacgacttctattgtgtacggtgaatgttttatgttttcttctataatttgaaatgtttttttttttctaacattaa
caactgtcgtaagtactaattgtgcattatgtataattggacggattaagcagcttacttattatatatgcaggtgacaa
accaggtgtttaggtatgccaaaaagg
back to top
>AF487200.1-LFY666
gcggtgagaaatgtcccaccaaggtacggagttacacccgtccctacgtttatacaaacgctaatttctaccgtggtaaa
tacttcgtcatttacaacctgatcgttgtggacccatcgttggctagtgggccgcaattggagaggcatgctgacacgtt
caatataaatgttcgaactaaatctaggagcccaagttcacaagaaataaaatcattaatagtttgttactaaattagga
acttagggttcgtttgggattatttctataggaacacttttattaaaagcacaacaaaaaggaagtgcatctccaacaac
cataaaaaatacttttagagtacaaaatcacttttaattatttcaaccgtgggtaaagaccaaatgttgacccactaata
attaatcagtcttcttctctttcatagttaaaaacacttgcactattttgtaggataaaaatctagacccagttgttggt
gcagacgacttctattgtgtacggtgaatgttttatgttttcttctataatttgaaatgttttttttttctaacattaac
aactgtcgtaagtactaattgtgcattatgtataattggacggattaagcagcttacttattatatatgcaggtgacaaa
ccaggtgtttaggtatgccaaaaagg
back to top
>AF487201.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487200.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top