LFY, LFY (gene) Neillia thibetica

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Neillia thibetica
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487184.1-LFYNeillia thibeticagene
LFYAF487183.1-LFYNeillia thibeticagene
LFYAF487182.1-LFYNeillia thibeticagene
LFYAF487181.1-LFYNeillia thibeticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487184.1-LFY.m1Neillia thibeticamRNA
LFYAF487183.1-LFY.m1Neillia thibeticamRNA
LFYAF487182.1-LFY.m1Neillia thibeticamRNA
LFYAF487181.1-LFY.m1Neillia thibeticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYNeillia thibeticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AF487184.1-LFY N/A AF487184.1
gene parsed from NCBI nr database AF487183.1-LFY N/A AF487183.1
gene parsed from NCBI nr database AF487182.1-LFY N/A AF487182.1
gene parsed from NCBI nr database AF487181.1-LFY N/A AF487181.1
mRNA parsed from NCBI nr database AF487184.1-LFY.m1 N/A AF487184.1
mRNA parsed from NCBI nr database AF487183.1-LFY.m1 N/A AF487183.1
mRNA parsed from NCBI nr database AF487182.1-LFY.m1 N/A AF487182.1
mRNA parsed from NCBI nr database AF487181.1-LFY.m1 N/A AF487181.1

Sequence(s):
>AF487184.1-LFY1424
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacactaatttctaccgtggtaaa
tactttgtcatttacaacctgatcgttgtgggcccatcgttggctagtgggccgcaattggagaggcattctgacacctt
caatataaatgttcgaactaaatctaggcgcccaagttcacaagaaataaaatcattaatagtttggtactaaattagga
actttgggttcgtttgggattacttttatcgaaaacacttttattaaaagcacaacaaaaaggaagtgtgtctccaacaa
ccctaaaaaatacttttagagtacaaaatcacttttaattatttcaaccatgggtcaagaccaaatgactcactaataat
taatcgtgttcttctctttcatagaaaaaatgcttatttattgatatgtcccctggaacatcacatttgttctactttgc
cccctgaaattttaaatgggtcacttaaccccctggaccaccataacgtgtatcactttgccccctgcaactttaaatag
gtcacttaacccctgaaccaccataccatgtatcactttgccccctggaccaccaccataccgtgtatcactttgccgtc
ttggcttaatcctttcaaatatatacatacctaaccactgtattcaccaaaattctggaatgaaaaagaaacaattctat
ttttctctcctctgttttctattgtctatgtcctgtttaaaatcttttactttgaacgagaactcacactaaacaatagt
gactatttcttgttttaaggggcttttggaatgagaaagaaacgacatagccctgattcaggaagataatgtacaatgta
atttcgggtttctggttagtaaatagggttatgttgtttgtttctgaataaggaagatgatgtacaatgtaagcacctta
ttaccctcaaagttaacgattcaattgacggaattggcgtgaaatgacaaagggatacacggtatggtggtctaggaggt
taagtgacccatttaaagttccagggggcaaagtgatacatggtatggtggtcagggggttaagtgacccatttaaagtt
tcagggggcaaactggaacaaatgtgatgtttcagggggcatatcaatagataagcctagaaaaaaacacttgcactatt
ttgtaggataaaaatctagacccaattgttggtgcagacgacttctattgtgtacgataggtgaatgttttatgttttct
tctataatttgaaatgtttttttttttctaacattaacaactgtcgtaagtactaattgtgcattatatataattggacg
gattaagcagcttacctattatatatgcaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487183.1-LFY1427
gcggtgagaaatgtcccaccaaggtacggatttacacccctccctacgtttttacaaacgctaattaatttctaccgtgg
taaatactttgtcatttacaacctgatcgttgtgggcccatcgttggctagtgggccgcaattggagaggcattctgaca
ccttcaatataaatgttcgaactaaatctaggcgcccaagttcacaagaaataaaatcattaatagtttggtactaaatt
aggaactttgggttcgtttgggattacttttatcgaaaacacttttattaaaagcacaacaaaaaggaagtgtgtctcca
acaaccctaaaaaatacttttagagtacaaaatcacttttaattatttcaaccatgggtcaagaccaaatgactcactaa
taattaatcgtgttcttctctttcatagaaaaaatgcttatttattgatatgtcccctggaacatcacatttgttctact
ttgccccctgaaattttaaatgggtcacttaaccccctggaccaccataacgtgtatcactttgccccctgcaactttaa
ataggtcacttaacccctgaaccaccataccatgtatcactttgccccctggaccaccaccataccgtgtatcactttgc
cgtcttggcttaatcctttcaaatatatacatacctaaccactgtattcaccaaaattttggaatgaaaaaaaaacaatt
ctatttttctctcctttgttttctattgtctatgtcctgtttaaaatcttttactttgaacgagaacttacactaaacaa
tagtgactattgcttgttttaaggggcttttggaatgagaaagaaacgacatagccctgattcaggaagataatgtacaa
tgtaatttcgggtttctggttagtaaatagggttatgttgtttgtttctgaataaggaagatgatgtacaatgtaagcac
cttattaccctcaaagttaacgattcaattgacggaattggcgtgaaatgacaaagtgatacacgatatggtggtctagg
aggttaagtgactcatttaaagttccagggggcaaagtgatacatggtatggtggccagggggttaagtgacccatttaa
agtttcagggggcaaactggaacaaatgtgatgtttcagggggcatatcaatagataagcctagaaaaaaacacttgcac
tattttgtaggataaaaatctagacccaattgttggtgcagacgacttctattgtgtacgataggtgaatgttttatgtt
ttcttccataatttgaaatgtttttttgttctaacattaacaactgtcgtaagtactaattgtgcattatatataattgg
acggattaagcagcttacctattatatatgcaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487182.1-LFY1427
gcggtgagaaatgtcccaccaaggtacggatttacacccctccctacgtttttacaaacgctaattaatttctaccgtgg
taaatactttgtcatttacaacctgatcgttgtgggcccatcgttggctagtgggccgcaattggagaggcattctgaca
ccttcaatataaatgttcgaactaaatctaggcgcccaagttcacaagaaataaaatcattaatagtttggtactaaatt
aggaactttgggttcgtttgggattacttttatcgaaaacacttttattaaaagcacaacaaaaaggaagtgtgtctgca
acaaccctaaaaaatacttttagagtacaaaatcacttttaattatttcaaccatgggtcaagaccaaatgactcactaa
taattaatcgtgttcttctctttcatagaaaaaatgcttatttattgatatgtcccctggaacatcacatttgttctact
ttgccccctgaaattttaaatgggtcacttaaccccctggaccaccataacgtgtatcactttgccccctgcaactttaa
ataggtcacttaacccctgaaccaccataccatgtatcactttgccccctggaccaccaccataccgtgtatcactttgc
cgtcttggcttaatcctttcaaatatatacatacctaaccactgtattcaccaaaattttggaatgaaaaaaaaacaatt
ctatttttctctcctctgttttctattgtctatgtcctgtttaaaatcttttactttgaacgagaacttacactaaacaa
tagtgactattgcttgttttaaggggcttttggaatgagaaagaaacgacatagccctgattcaggaagataatgtacaa
tgtaatttcgggtttctggttagtaaatagggttatgttgtttgtttctgaataaggaagatgatgtacaatgtaagcac
cttattaccctcaaagttaacgattcaattgacggaattggcgtgaaatgacaaagtgatacacgatatggtggtctagg
aggttaagtgactcatttaaagttccagggggcaaagtgatacatggtatggtggccagggggttaagtgacccatttaa
agtttcagggggcaaactggaacaaatgtgatgtttcagggggcatatcaatagataagcctagaaaaaaacacttgcac
tattttgtaggataaaaatctagacccaattgttggtgcagacgacttctattgtgtacgataggtgaatgttttatgtt
ttcttccataatttgaaatgtttttttgttctaacattaacaactgtcgtaagtactaattgtgcattatatataattgg
acggattaagcagcttacctattatatatgcaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487181.1-LFY1428
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacactaatttctaccgtggtaaa
tactttgtcatttacaacctgatcgttgtgggcccatcgttggctagtgggccgcaattggagaggcattctgacacctt
caatataaatgttcgaactaaatctagaatctaggagcccaagttcacaagaaataaaatcattaatagtttggtactaa
attaggaactttgggttcgtttgggattacttttatcgaaaacacttttattaaaagcacaacaaaaaggaagtgtgtct
ccaacaaccataaaaaatactagagtacaaaatcacttttaattatttcaaccatgggtcaagaccaaatgactcactaa
taattaatcgtgttcttctctttcatagaaaaaaggcttatttattgatatgccccctggaacatcacatttgttccact
ttgccccatgaaattttaaatgggtcacttaaccccctggaccaccataacgtgtatcactttgccccctgtaactttaa
ataggtcacttaacccctgaaccaccataccatgtatcactttgccccctggaccaccaccataccgtgtatcactttgc
cgtcttggcttaatcctttcaaatatatacatacctaaccactgtattcaccaaaattctggaatgaaaaagaaacaatt
ctatttttctctcctctgttttctattgtctatgtcctgtttaaaatcttttactttgaacgagaactcacactaaacaa
tagtgactatttcttgttttaaggggcttttggaatgagaaagaaacgacatagccctgattcaggaagataatgtacaa
tgtaatttcgggtttctggttagtaaatagggttatgttgtttgtttctgaataaggaagatgatgtacaatgtaagcac
cttattaccctcaaagttaacgattcaattgacggaattggcgtgaaatgacaaagggatacacggtatggtggtctagg
aggttaagtgacccatttaaagttccagggggcaaagtgatacatggtatggtggtcagggggttaagtgacccatttaa
agtttcagggggcaaactggaacaaatgtgatgtttcagggggcatatcaatagataagcctagaaaaaaacacttgcac
tattttgtaggataaaaatctagacccaattgttggtgcagacgacttctattgtgtacgataggtgaatgttttatgtt
ttcttctataatttgaaatgtttttttttttctaacattaacaactgtcgtaagtactaattgtgcattatatataattg
gacggattaagcagcttacctattatatatgcaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487184.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487183.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487182.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487181.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top