LFY, LFY (gene) Neillia thyrsiflora

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Neillia thyrsiflora
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487192.1-LFYNeillia thyrsifloragene
LFYAF487191.1-LFYNeillia thyrsifloragene
LFYAF487190.1-LFYNeillia thyrsifloragene
LFYAF487189.1-LFYNeillia thyrsifloragene
LFYAF487188.1-LFYNeillia thyrsifloragene
LFYAF487187.1-LFYNeillia thyrsifloragene
LFYAF487186.1-LFYNeillia thyrsifloragene
LFYAF487185.1-LFYNeillia thyrsifloragene
LFYAF487159.1-LFYNeillia thyrsifloragene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487192.1-LFY.m1Neillia thyrsifloramRNA
LFYAF487191.1-LFY.m1Neillia thyrsifloramRNA
LFYAF487190.1-LFY.m1Neillia thyrsifloramRNA
LFYAF487189.1-LFY.m1Neillia thyrsifloramRNA
LFYAF487188.1-LFY.m1Neillia thyrsifloramRNA
LFYAF487187.1-LFY.m1Neillia thyrsifloramRNA
LFYAF487186.1-LFY.m1Neillia thyrsifloramRNA
LFYAF487185.1-LFY.m1Neillia thyrsifloramRNA
LFYAF487159.1-LFY.m1Neillia thyrsifloramRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYNeillia thyrsifloragene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AF487192.1-LFY N/A AF487192.1
gene parsed from NCBI nr database AF487191.1-LFY N/A AF487191.1
gene parsed from NCBI nr database AF487190.1-LFY N/A AF487190.1
gene parsed from NCBI nr database AF487189.1-LFY N/A AF487189.1
gene parsed from NCBI nr database AF487188.1-LFY N/A AF487188.1
gene parsed from NCBI nr database AF487187.1-LFY N/A AF487187.1
gene parsed from NCBI nr database AF487186.1-LFY N/A AF487186.1
gene parsed from NCBI nr database AF487185.1-LFY N/A AF487185.1
gene parsed from NCBI nr database AF487159.1-LFY N/A AF487159.1
mRNA parsed from NCBI nr database AF487192.1-LFY.m1 N/A AF487192.1
mRNA parsed from NCBI nr database AF487191.1-LFY.m1 N/A AF487191.1
mRNA parsed from NCBI nr database AF487190.1-LFY.m1 N/A AF487190.1
mRNA parsed from NCBI nr database AF487189.1-LFY.m1 N/A AF487189.1
mRNA parsed from NCBI nr database AF487188.1-LFY.m1 N/A AF487188.1
mRNA parsed from NCBI nr database AF487187.1-LFY.m1 N/A AF487187.1
mRNA parsed from NCBI nr database AF487186.1-LFY.m1 N/A AF487186.1
mRNA parsed from NCBI nr database AF487185.1-LFY.m1 N/A AF487185.1
mRNA parsed from NCBI nr database AF487159.1-LFY.m1 N/A AF487159.1

Sequence(s):
>AF487192.1-LFY666
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacgctaatttctaccgtggtaaa
tacttcgtcatttacaacctgattgttgtgggcccatcgttggctagtgggccgcaattggagaagcatgctgacacgtt
caatataaatgttcgaactaaatgtaggagcccaagttcacaagaaataaaatcattataatagtttgttactaaattag
gaactttgggttcgtttggtattacttctatggaaacacttttattaaaagcacaacaaaaaggaagtgcatctccaaca
accataaaaaatacttttagagtacaaaatcacttttaattatttcaaccatgggtcaagaccaaatgttgacccactaa
taattaatcgtgttcttgtctttcatagtaaaaaacacttgcactattttgtaggataaaaatctagacccaattgttgg
tgcagacgacttctattgtgtacggtgaatgttttatgttttcttctataatttgaaatgtttttttttctaacattaac
aactgtcgtaagtactaattgtgcattatgtataattggacggattaagcagcctacttattatatatgcaggtgacaaa
ccaggtgtttaggtatgccaaaaagg
back to top
>AF487191.1-LFY667
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacgctaatttctaccgtggtaaa
tacttcgtcatttacaacctgattgttgtgggcccatcgttggctagtgggccgcaattggagaagcatgctgacacgtt
caatataaatgttcgaactaaatgtaggagcccaagttcacaagaaataaaatcattataatagtttgttactaaattag
gaactttgggttcgtttggtattacttctatggaaacacttttattaaaagcacaacaaaaaggaagtgcatctccaaca
accataaaaaatacttttagagtacaaaatcacttttaattatttcaaccatgggtcaagaccaaatgttgacccactaa
taattaatcgtgttcttgtctttcatagtaaaaaacacttgcactattttgtaggataaaaatctagacccaattgttgg
tgcagacgacttctattgtgtacggtgaatgttttatgttttcttctataatttgaaatgttttttttttctaacattaa
caactgtcgtaagtactaattgtgcattatgtataattggacggattaagcagcctacttattatatatgcaggtgacaa
accaggtgtttaggtatgccaaaaagg
back to top
>AF487190.1-LFY667
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacgctaatttctaccgtggtaaa
tacttcgtcatttataacctgattgttgtgggcccatcgttggctagtgggccgcaattggagaagcatgctgacacgtt
caatataaatgttcgaactaaatgtaggagcccaagttcacaagaaataaaatcattataatagtttgttactaaattag
gaactttgggttcgtttggtattacttctatggaaacacttttattaaaagcacaacaaaaaggaagtgcatctccaaca
accataaaaaatacttttagagtacaaaatcacttttaattatttcaaccatgggtcaagaccaaatgttgacccactaa
taattaatcgtgttcttgtctttcatagtaaaaaacacttgcactattttgtaggataaaaatctagacccaattgttgg
tgcagacgacttctattgtgtacggtgaatgttttatgttttcttctataatttgaaatgttttttttttctaacattaa
caactgtcgtaagtactaattgtgcattatgtataattggacggattaagcagcctacttattatatatgcaggtgacaa
accaggtgtttaggtatgccaaaaagg
back to top
>AF487189.1-LFY667
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacgctaatttctaccgtggtaaa
tacttcgtcatttataacctgattgttgtgggcccatcgttggctagtgggccgcaattggagaagcatgctgacacgtt
caatataaatgttcgaactaaatgtaggagcccaagttcacaagaaataaaatcattataatagtttgttactaaattag
gaactttgggttcgtttggtattacttctatggaaacacttttattaaaagcacaacaaaaaggaagtgcatctccaaca
accataaaaaatacttttagagtgcaaaatcacttttaattatttcaaccatgggtcaagaccaaatgttgacccactaa
taattaatcgtgttcttgtctttcatagtaaaaaacacttgcactattttgtaggataaaaatctagacccaattgttgg
tgcagacgacttctattgtgtacggtgaatgttttatgttttcttctataatttgaaatgttttttttttctaacattaa
caactgtcgtaagtactaattgtgcattatgtataattggacggattaagcagcctacttattatatatgcaggtgacaa
accaggtgtttaggtatgccaaaaagg
back to top
>AF487188.1-LFY667
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacgctaatttctaccgtggtaaa
tacttcgtcatttataacctgattgttgtgggcccatcgttggctagtgggccgcaattggagaagcatgctgacacgtt
caatataaatgttcgaactaaatgtaggagcccaagttcacaagaaataaaatcattataatagtttgttactaaattag
gaactttgggttcgtttggtattacttctatggaaacacttttattaaaagcacaacaaaaaggaagtgcatctccaaca
accataaaaaatacttttagagtacaaaatcacttttaattatttcaaccatgggtcaagaccaaatgttgacccactaa
taattaatcgtgttcttgtctttcataataaaaaacacttgcactattttgtaggataaaaatctagacccaattgttgg
tgcagacgacttctattgtgtacggtgaatgttttatgttttcttctataatttgaaatgttttttttttctaacattaa
caactgtcgtaagtactaattgtgcattatgtataattggacggattaagcagcctacttattatatatgcaggtgacaa
accaggtgtttaggtatgccaaaaagg
back to top
>AF487187.1-LFY667
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacgctaatttctaccgtggtaaa
tacttcgtcatttacaacctgattgttgtgggcccatcgttggctagtgggccgcaattggagaggcatgctggcacgtt
caatataaatgttggaactaaatctaggagcccaagttcacaagaaataaaatcattaatagtttgtttctaaattagga
actttggcgtttggtattacttctatggaaacacttttattaaaagcacaacaaaaaggaagtgcatctccaacaaccat
aaaaaatacttttagagtacaaaatcacttttaattatttcaaccatgggtcaagaccaaatgttgaccaaaatcactaa
taattaatcgtgttcttgtctttcatagtaaaaaacacttgcactattttgtaggataaaaatctaggcccaattgttgg
tgcagacgacttctattgtgtacggtgaatgttttatgttttcttctataatttgaaatgttttttttttctaacattaa
caactgtcgtaagtactaattgtgcattatgtataattggacggattaagcagcttacttattatatatgcaggtgacaa
accaggtgtttaggtatgccaaaaagg
back to top
>AF487186.1-LFY666
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacgctaatttctaccgtggtaaa
tacttcgtcatttacaacctgattgttgtgggcccatcgttggctagtgggccgcaattggagaggcatgctgacacgtt
caatataaatgttggaactaaatctaggagcccaagttcacaagaaataaaatcattaatagtttgtttctaaattagga
actttggcgtttggtattacttctatggaaacacttttattaaaagcacaacaaaaaggaagtgcatctccaacaaccat
aaaaaatacttttagagtacaaaatcacttttaattatttcaaccatgggtcaagaccaaatgttgaccaaaatcactaa
taattaatcgtgttcttgtctttcatagtaaaaaacacttgcactattttgtaggataaaaatctaggcccaattgttgg
tgcagacgacttctattgtgtacggtgaatgttttatgttttcttctataatttgaaatgtttttttttctaacattaac
aactgtcgtaagtactaattgtgcattatgtataattggacggattaggcagcttacttattatatatgcaggtgacaaa
ccaggtgtttaggtatgccaaaaagg
back to top
>AF487185.1-LFY667
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacgctaatttctaccgtggtaaa
tacttcgtcatttacaacctgattgttgtgggcccatcgttggctagtgggccgcaattggagaggcatgctgacacgtt
caatataaatgttggaactaaatctaggagcccaagttcacaagaaataaaatcattaatagtttgtttctaaattagga
actttggcgtttggtattacttctatggaaacacttttattaaaagcacaacaaaaaggaagtgcatctccaacaaccat
aaaaaatacttttagagtacaaaatcacttttaattatttcaaccatgggtcaagaccaaatgttgaccaaaatcactaa
taattaatcgtgttcttgtctttcatagtaaaaaacacttgcactattttgtaggataaaaatctaggcccaattgttgg
tgcagacgacttctattgtgtacggtgaatgttttatgttttcttctataatttgaaatgttttttttttctaacattaa
caactgtcgtaagtactaattgtgcattatgtataattggacggattaagcagcttacttattatatatgcaggtgacaa
accaggtgtttaggtatgccaaaaagg
back to top
>AF487159.1-LFY784
gtggcacgtggcaaaaagaacggcctcgattacctcttccatctctacgagcagtgccgtgatttcttgatccaggtcca
gaacattgccaaggagcgcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacgcta
atttctaccgtggtaaatacttcgtcatttacaacctgattgttgtgggcccatcgttggctagtgggccgcaattggag
aggcatgctgacacgttcaatataaatgttggaactaaatctaggagcccaagttcacaagaaataaaatcattaatagt
ttgtttctaaattaggaactttggcgtttggtattacttctatggaaacacttttattaaaagcacaacaaaaaggaagt
gcatctccaacaaccataaaaaatacttttagagtacaaaatcacttttaattatttcaaccatgggtcaagaccaaatg
ttgaccaaaatcactaataattaatcgtgttcttgtctttcatagtaaaaaacacttgcactattttgtaggataaaaat
ctaggcccaattgttggtgcagacgacttctattgtgtacggtgaatgttttatgttttcttctataatttgaaatgttt
tttttttctaacattaacaactgtcgtaagtactaattgtgcattatgtataattggacggattaagcagcttacttatt
atatatgcaggtgacaaaccaggtgtttaggtatgccaaaaaggcaggggcaagctacatcaac
back to top
>AF487192.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487191.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487190.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487189.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487188.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487187.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487186.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487185.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487159.1-LFY.m1174
gtggcacgtggcaaaaagaacggcctcgattacctcttccatctctacgagcagtgccgtgatttcttgatccaggtcca
gaacattgccaaggagcgcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaaggcagggg
caagctacatcaac
back to top