LFY, LFY (gene) Neillia uekii

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Neillia uekii
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487194.1-LFYNeillia uekiigene
LFYAF487193.1-LFYNeillia uekiigene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487194.1-LFY.m1Neillia uekiimRNA
LFYAF487193.1-LFY.m1Neillia uekiimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYNeillia uekiigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AF487194.1-LFY N/A AF487194.1
gene parsed from NCBI nr database AF487193.1-LFY N/A AF487193.1
mRNA parsed from NCBI nr database AF487194.1-LFY.m1 N/A AF487194.1
mRNA parsed from NCBI nr database AF487193.1-LFY.m1 N/A AF487193.1

Sequence(s):
>AF487194.1-LFY673
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacgctaatttctaccgtggtaaa
tactttgtcatttacaacctgatcgttgtgggcccatcgttggctagtgggccgcaattggagaggcatgctgacacctt
caatatatatgttcgaactaaatctgggagcccaagttcacaagaaataaaatcattaatagtttgttcctaaattagga
actttgggttcatttgggattacttctatagaaaacactttcattaaaagcacaacaaaaaggaagtgcgtctccaacaa
ccatcaaaaatacttttagagtacaaaatcacttttaattatctcaaccatgggtcaagaccaaatgttgacccactaat
aattaatcgtgttcttttctttcatagaaaaaaacacttgcactattgtgtaggataaaaatctagacccaattgttggt
gcagacgacttctattgtgtacgataggtgaatgttttatgttttcttctataatttgaaatgttttttttattttctaa
cattaacaactgtcgtgggtactaattgtgcattatatataattggacggattaagcagcttacctattatatatgcagg
tgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487193.1-LFY673
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtttttacaaacgctaatttctaccgtggtaaa
tactttgtcatttacaacctgatcgttgtgggcccatcgttggctagtgggccgcaattggagaggcatgctgacacctt
caatatatatgttcgaactaaatctgggagcccaagttcacaagaaataaaatcattaatagtttgttcctaaattagga
actttgggttcatttgggattacttctatagaaaacactttcattaaaagcacaacaaaaaggaagtgcgtctccaacaa
ccatcaaaaatacttttagagtacaaaatcacttttaattatctcaaccatgggtcaagaccaaatgttgacccactaat
aattaatcgtgttcttttctttcatagaaaaaaacacttgcactattgtgtaggataaaaatctagacccaattgttggt
gcagacgacttctattgtgtacgataggtgaatgttttatgttttcttctataatttgaaatgttttttttattttctaa
cattaacaactgtcgtgggtactaattgtgcattatatataattggacggattaagcagcttacctattatatatgcagg
tgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487194.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487193.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top