LFY, LFY (gene) Physocarpus alternans

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Physocarpus alternans
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAY555338.1-LFYPhysocarpus alternansgene
LFYAY555337.1-LFYPhysocarpus alternansgene
LFYAY555336.1-LFYPhysocarpus alternansgene
LFYAY555335.1-LFYPhysocarpus alternansgene
LFYAY555334.1-LFYPhysocarpus alternansgene
LFYAY555333.1-LFYPhysocarpus alternansgene
LFYAY555332.1-LFYPhysocarpus alternansgene
LFYAY555331.1-LFYPhysocarpus alternansgene
LFYAY555330.1-LFYPhysocarpus alternansgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAY555338.1-LFY.m1Physocarpus alternansmRNA
LFYAY555337.1-LFY.m1Physocarpus alternansmRNA
LFYAY555336.1-LFY.m1Physocarpus alternansmRNA
LFYAY555335.1-LFY.m1Physocarpus alternansmRNA
LFYAY555334.1-LFY.m1Physocarpus alternansmRNA
LFYAY555333.1-LFY.m1Physocarpus alternansmRNA
LFYAY555332.1-LFY.m1Physocarpus alternansmRNA
LFYAY555331.1-LFY.m1Physocarpus alternansmRNA
LFYAY555330.1-LFY.m1Physocarpus alternansmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPhysocarpus alternansgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AY555338.1-LFY N/A AY555338.1
gene parsed from NCBI nr database AY555337.1-LFY N/A AY555337.1
gene parsed from NCBI nr database AY555336.1-LFY N/A AY555336.1
gene parsed from NCBI nr database AY555335.1-LFY N/A AY555335.1
gene parsed from NCBI nr database AY555334.1-LFY N/A AY555334.1
gene parsed from NCBI nr database AY555333.1-LFY N/A AY555333.1
gene parsed from NCBI nr database AY555332.1-LFY N/A AY555332.1
gene parsed from NCBI nr database AY555331.1-LFY N/A AY555331.1
gene parsed from NCBI nr database AY555330.1-LFY N/A AY555330.1
mRNA parsed from NCBI nr database AY555338.1-LFY.m1 N/A AY555338.1
mRNA parsed from NCBI nr database AY555337.1-LFY.m1 N/A AY555337.1
mRNA parsed from NCBI nr database AY555336.1-LFY.m1 N/A AY555336.1
mRNA parsed from NCBI nr database AY555335.1-LFY.m1 N/A AY555335.1
mRNA parsed from NCBI nr database AY555334.1-LFY.m1 N/A AY555334.1
mRNA parsed from NCBI nr database AY555333.1-LFY.m1 N/A AY555333.1
mRNA parsed from NCBI nr database AY555332.1-LFY.m1 N/A AY555332.1
mRNA parsed from NCBI nr database AY555331.1-LFY.m1 N/A AY555331.1
mRNA parsed from NCBI nr database AY555330.1-LFY.m1 N/A AY555330.1

Sequence(s):
>AY555338.1-LFY902
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaattgacaacctgatctttgtgggctaattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgtcacttagcactacggtttagtaggatttttcttcacttgtaagtcagaggtcttaggttcaagtctcgg
caagcccattatgtggcttagtctaattctcaccctttagtgtaaatatcgttgtatttaaaaaaaaactaatttaggaa
ctttggattcctttgggattacttctagagaatacacttttacctataaatacttcttttagtaaaagcacaacaaaagc
actcgggagtgcttctctaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggatttt
tgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgtta
gacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtg
cattcgactattattgtatccgataggtgaatgttttcttttttgttctacagtttgtagtgtttttaactaacattaac
aactgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccag
gtgtttaggtatgccaaaaagg
back to top
>AY555337.1-LFY901
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagagcctgctgacacct
tcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattta
ggaattttgccacttagcactacggtttagtaggatttttcttcacttgtaagtcagaggtcttaggttcaagtctcggc
aagcccattatgtggcttagtctaattctcaccctttagtgtaaatatcgttgtatttaaaaaaaaactaatttaggaac
tttggattcctttgggattacttctagagaatacacttttacctataaatacttcttttactaaaagcacaacaaaagca
ctcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggattttt
gaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
acagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattattgtatccgataggtgaatgttttcttttttgttctacagtttgaagtgtttttaactaacattaaca
actgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccagg
tgtttaggtatgccaaaaagg
back to top
>AY555336.1-LFY902
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaattgacaacctgatctttgtgggctaattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgtcacttagcactacggtttagtaggatttttcttcacttgtaagtcagaggtcttaggttcaagtctcgg
caagcccattatgtggcttagtctaattctcaccctttagtgtaaatatcgttgtatttaaaaaaaaactaatttaggaa
ctttggattcctttgggattacttctagagaatacacttttacctataaatacttcttttagtaaaagcacaacaaaagc
actcgggagtgcttctctaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggatttt
tgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgtta
gacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtg
cattcgactattattgtatccgataggtgaatgttttcttttttgttctacagtttgaagtgtttttaactaacattaac
aactgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccag
gtgtttaggtatgccaaaaagg
back to top
>AY555335.1-LFY1159
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagagcctgctgacacct
tcaatataaatgtttgagctaactgtaggagtccaaattcacaagaaatcaaaatctttaataggtttgttactaattta
ggaattttgccacttagcactacggtttagtagtatttctcttcatttgtaagtcagaggtcttaggttcaagtctcggc
aagcccattgtgtggtttagtctaattttcacccctttagtgtaaatatcgttgtatttaaaaaaaaaactaatttagga
actttggattcctttgggattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaag
cactcgggagtgcttctccaagaaccataaaaatgcgttcattcttttaaccaaacactatcagcagcacttgtggattt
ttgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaatttggtttgactggccagatgtta
gacagtgattgatttcaagcatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtg
cattcgactattatggtgcgtttactaatcgggtatgaaattagaaggtatgggtatgagggtgggaaggtatgggtatg
agataaacaacccccccttaggtatgggatacctgataaaatcaggtatgagaggatatggaaggcaaaaaattcatgtg
ggccccatatattaattgatttcttaggtgaagtaaacataggatatgcaaggtatgggtatcatacccataccttgcat
acccataccttgtaagtaaacacaccattattgtatccgataggtgaatgttttcttttttgttctacagtttgaagtgt
ttttaactaacattaacaactgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatata
tgcaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555334.1-LFY1160
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcattacggtttagtaggatttctcttcacttgtaagtcaaaggttttaggttcaagtctcgg
caagcccattgtgtggcttagtctaattctcacccctttagtgtaaatatcgttgtatttaaaaaaaaaactaatttagg
aactttggattcctttgggattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaa
gcactcgggagtgcttctccaagaaccataaaaatgctttcattcttttaaccaaacactatcagcagcacttgtggatt
tttgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaatttggtttgactggccagatgtt
agacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagt
gcattcgactattatggtgcgtttactaatcgggtatgaaattagaaggtatgggtatgagggtgggaaggtatgggtat
gagataaacaacccccccttaggtatgggatacctgataaaatcaggtatgagaggatatggaaggcaaaaaattcatgt
gggccccatatattaattgatttcttaggtgaagtaaacataggatatgcaaggtatgggtatcatacccataccttgca
tacccataccttgtaagtaaacacaccattattgtatccgataggtgaatgttttcttttttgttctacagtttgaagtg
tttttaactaacattaacaactgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatat
atgcaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555333.1-LFY902
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcattacggtttagtaggatttctcttcacttgcaagtcaaaggttttaggttcaagtctcgg
caagcccattgtgtggcttagtctaattctcacccctttagtgtaaatatcgttgtatttaaaaaaaaactaatttagga
actttggattcctttgggattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaag
cactcgggagtgcttctccaagaaccataaaaatgctttcattcttttaaccaaacactatcagcagcacttgtggattt
ttgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaatttggtttgactggccagatgtta
gacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtg
cattcgactattattgtatccgataggtgaatgtcttcttttttgttctacagtttgaagtgtttttaactaacattaac
aactgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccag
gtgtttaggtatgccaaaaagg
back to top
>AY555332.1-LFY903
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacagttgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcattacggtttagtaggatttctcttcacttgtaagtcaaaggttttaggttcaagtctcgg
caagcccattgtgtggcttagtctaattctcacccctttagtgtaaatatcgttgtatttaaaaaaaaaactaatttagg
aactttggattcctttgggattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaa
gcactcgggagtgcttctccaagaaccataaaaatgctttcattcttttaaccaaacactatcagcagcacttgtggatt
tttgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaatttggtttgactggccagatgtt
agacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagt
gcattcgactattattgtatccgataggtgaatgtcttcttttttgttctacagtttgaagtgtttttaactaacattaa
caactgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaacca
ggtgtttaggtatgccaaaaagg
back to top
>AY555331.1-LFY903
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcattacggtttagtaggatttctcttcacttgtaagtcaaaggttttaggttcaagtctcgg
caagcccattgtgtggcttagtctaattctcacccctttagtgtaaatatcgttgtatttaaaaaaaaaactaatttagg
aactttggattcctttgggattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaa
gcactcgggagtgcttctccaagaaccataaaaatgctttcattcttttaaccaaacactatcagcagcacttgtggatt
tttgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaatttggtttgactggccagatgtt
agacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagt
gcattcgactattattgtatccgataggtgaatgtcttcttttttgttctacagtttgaagtgtttttaactaacattaa
caactgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaacca
ggtgtttaggtatgccaaaaagg
back to top
>AY555330.1-LFY903
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcattacggtttagtaggatttctcttcacttgtaagtcaaaggttttaggttcaagtctcgg
caagcccattgtgtggcttagtctaattctcacccctttagtgtaaatatcgttgtatttaaaaaaaaaactaatttagg
aactttggattcctttgggattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaa
gcactcgggagtgcttctccaagaaccataaaaatgctttcattcttttaaccaaacactatcagcagcacttgtggatt
tttgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaatttggtttgactggccagatgtt
agacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagt
gcattcgactattattgtatccgataggtgaatgtcttcttttttgttctacagtttgaagtgtttttaactaacattaa
caactgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaacca
ggtgtttaggtatgccaaaaagg
back to top
>AY555338.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555337.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555336.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555335.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555334.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555333.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555332.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555331.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555330.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top