LFY, LFY (gene) Physocarpus amurensis

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Physocarpus amurensis
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487169.1-LFYPhysocarpus amurensisgene
LFYAF487168.1-LFYPhysocarpus amurensisgene
LFYAF487167.1-LFYPhysocarpus amurensisgene
LFYAF487166.1-LFYPhysocarpus amurensisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAF487169.1-LFY.m1Physocarpus amurensismRNA
LFYAF487168.1-LFY.m1Physocarpus amurensismRNA
LFYAF487167.1-LFY.m1Physocarpus amurensismRNA
LFYAF487166.1-LFY.m1Physocarpus amurensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPhysocarpus amurensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AF487169.1-LFY N/A AF487169.1
gene parsed from NCBI nr database AF487168.1-LFY N/A AF487168.1
gene parsed from NCBI nr database AF487167.1-LFY N/A AF487167.1
gene parsed from NCBI nr database AF487166.1-LFY N/A AF487166.1
mRNA parsed from NCBI nr database AF487169.1-LFY.m1 N/A AF487169.1
mRNA parsed from NCBI nr database AF487168.1-LFY.m1 N/A AF487168.1
mRNA parsed from NCBI nr database AF487167.1-LFY.m1 N/A AF487167.1
mRNA parsed from NCBI nr database AF487166.1-LFY.m1 N/A AF487166.1

Sequence(s):
>AF487169.1-LFY917
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatatgaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcactacggttgagtagtattgttgagtagtatttttcttcacttataagtcagaggtcttag
gttcaagtctcggcaagcccattgtgtagcttagtctaattctcacccttttagtgtaaatatcgttgtatttaaaaaaa
aatttaatttaggaactttgaattcctttgaaattacttctatagaatacacttttacctataaatacttcttttactaa
aagcacagcaaaagcattcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagca
acacttgtggatttttgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttg
actggccagatgttagacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctag
acccaattgttagtgcatttgactattattgtatccgataggtgaatgttttcttttttgttctacagtttgaagtgttt
ttaactaacattaacaactgtcgtaagtactaacggtgcataataattagaaggattaagtatcttacttattatatatg
caggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487168.1-LFY916
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatatgaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcactacggttgagtagtattgttgagtagtatttttcttcacttataagtcagaggtcttag
gttcaagtctcggcaagcccattgtgtagcttagtctaattctcacccttttagtgtaaatatcgttgtatttaaaaaaa
atttaatttaggaactttgaattcctttgaaattacttctatagaatacacttttacctataaatacttcttttactaaa
agcacagcaaaagcattcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcaa
cacttgtggatttttgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttga
ctggccagatgttagacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctaga
cccaattgttagtgcatttgactattattgtatccgataggtgaatgttttcttttttgttctacagtttgaagtgtttt
taactaacattaacaactgtcgtaagtactaacggtgcataataattagaaggattaagtatcttacttattatatatgc
aggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487167.1-LFY916
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatatgaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcactacggttgagtagtattgttgagtagtatttttcttcacttataagtcagaggtcttag
gttcaagtctcggcaagcccattgtgtagcttagtctaattctcacccttttagtgtaaatatcgttgtatttaaaaaaa
aattaatttaggaactttgaattcctttgaaattacttctatagaatacacttttacctataaatacttcttttactaaa
agcacagcaaaagcattcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcaa
cacttgtggatttttgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttga
ctggccagatgttagacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctaga
cccaattgttagtgcatttgactattattgtatccgataggtgaatgttttcttttttgttctacagtttgaagtgtttt
taactaacattaacaactgtcgtaagtactaacggtgcataataattagaaggattaagtatcttacttattatatatgc
aggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487166.1-LFY917
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatatgaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcactacggttgagtagtattgttgagtagtatttttcttcacttataagtcagaggtcttag
gttcaagtctcggcaagcccattgtgtagcttagtctaattctcacccttttagtgtaaatatcgttgtatttaaaaaaa
aaattaatttaggaactttggattcctttgaaattacttctatagaatacacttttacctataaatacttcttttactaa
aagcacagcaaaagcattcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagca
acacttgtggatttttgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttg
actggccagatgttagacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctag
acccaattgttagtgcatttgactattattgtatccgataggtgaatgttttcttttttgttctacagtttgaagtgttt
ttaactaacattaacaactgtcgtaagtactaacggtgcataataattagacggattaagtatcttacttattatatatg
caggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487169.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487168.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487167.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487166.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top