LFY, LFY (gene) Physocarpus capitatus

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Physocarpus capitatus
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAY555344.1-LFYPhysocarpus capitatusgene
LFYAY555343.1-LFYPhysocarpus capitatusgene
LFYAY555342.1-LFYPhysocarpus capitatusgene
LFYAY555341.1-LFYPhysocarpus capitatusgene
LFYAY555340.1-LFYPhysocarpus capitatusgene
LFYAY555339.1-LFYPhysocarpus capitatusgene
LFYAF487174.1-LFYPhysocarpus capitatusgene
LFYAF487173.1-LFYPhysocarpus capitatusgene
LFYAF487172.1-LFYPhysocarpus capitatusgene
LFYAF487171.1-LFYPhysocarpus capitatusgene
LFYAF487170.1-LFYPhysocarpus capitatusgene
LFYAF487161.1-LFYPhysocarpus capitatusgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAY555344.1-LFY.m1Physocarpus capitatusmRNA
LFYAY555343.1-LFY.m1Physocarpus capitatusmRNA
LFYAY555342.1-LFY.m1Physocarpus capitatusmRNA
LFYAY555341.1-LFY.m1Physocarpus capitatusmRNA
LFYAY555340.1-LFY.m1Physocarpus capitatusmRNA
LFYAY555339.1-LFY.m1Physocarpus capitatusmRNA
LFYAF487174.1-LFY.m1Physocarpus capitatusmRNA
LFYAF487173.1-LFY.m1Physocarpus capitatusmRNA
LFYAF487172.1-LFY.m1Physocarpus capitatusmRNA
LFYAF487171.1-LFY.m1Physocarpus capitatusmRNA
LFYAF487170.1-LFY.m1Physocarpus capitatusmRNA
LFYAF487161.1-LFY.m1Physocarpus capitatusmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPhysocarpus capitatusgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AY555344.1-LFY N/A AY555344.1
gene parsed from NCBI nr database AY555343.1-LFY N/A AY555343.1
gene parsed from NCBI nr database AY555342.1-LFY N/A AY555342.1
gene parsed from NCBI nr database AY555341.1-LFY N/A AY555341.1
gene parsed from NCBI nr database AY555340.1-LFY N/A AY555340.1
gene parsed from NCBI nr database AY555339.1-LFY N/A AY555339.1
gene parsed from NCBI nr database AF487174.1-LFY N/A AF487174.1
gene parsed from NCBI nr database AF487173.1-LFY N/A AF487173.1
gene parsed from NCBI nr database AF487172.1-LFY N/A AF487172.1
gene parsed from NCBI nr database AF487171.1-LFY N/A AF487171.1
gene parsed from NCBI nr database AF487170.1-LFY N/A AF487170.1
gene parsed from NCBI nr database AF487161.1-LFY N/A AF487161.1
mRNA parsed from NCBI nr database AY555344.1-LFY.m1 N/A AY555344.1
mRNA parsed from NCBI nr database AY555343.1-LFY.m1 N/A AY555343.1
mRNA parsed from NCBI nr database AY555342.1-LFY.m1 N/A AY555342.1
mRNA parsed from NCBI nr database AY555341.1-LFY.m1 N/A AY555341.1
mRNA parsed from NCBI nr database AY555340.1-LFY.m1 N/A AY555340.1
mRNA parsed from NCBI nr database AY555339.1-LFY.m1 N/A AY555339.1
mRNA parsed from NCBI nr database AF487174.1-LFY.m1 N/A AF487174.1
mRNA parsed from NCBI nr database AF487173.1-LFY.m1 N/A AF487173.1
mRNA parsed from NCBI nr database AF487172.1-LFY.m1 N/A AF487172.1
mRNA parsed from NCBI nr database AF487171.1-LFY.m1 N/A AF487171.1
mRNA parsed from NCBI nr database AF487170.1-LFY.m1 N/A AF487170.1
mRNA parsed from NCBI nr database AF487161.1-LFY.m1 N/A AF487161.1

Sequence(s):
>AY555344.1-LFY905
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcactacgatctagtggtatttctcttcacttgtaagtcagaggtcttaggttcaagtctcg
gcaaatccattgtgtggcttagcctaattctcacacttttagtgtaaatatcgttgtatttaaaaaaaaaactaatttag
gaactttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaa
agcactagggagtgcgtctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggat
ttttgaaagcacttttagccctgtaatataggctctaaatattccaacatttatctaaatttggtttgactggccagatg
ttagacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgtta
gtgcattcgactattattatatccgataggtgaatgttttcttttttgttctacagtttgaagtgtttttaactaacatt
aacaactgtcgtaagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaac
caggtgtttaggtatgccaaaaagg
back to top
>AY555343.1-LFY905
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttagtaggtttgttactaatt
taggaactttgccacttagcactacgatctagtggtatttctcttcacttgtaagtcagaggtcttaggttcaagtctcg
gcaaatccattgtgtggcttagcctaattctcacacttttagtgtaaatatcgttgtatttaaaaaaaaaactaatttag
gaactttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaa
agcactcgggagtgcgtctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggat
ttttgaaagcacttttagccctgtaatataggctctaaatattccaacatttatctaaatttggtttgactggccagatg
ttagacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgtta
gtgcattcgactattattgtatcccataggtgaatgttttcttttttgttctacagtttgaagtgtttttaactaacatt
aacaattgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaac
caagtgtttaggtatgccaaaaagg
back to top
>AY555342.1-LFY905
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaattttgccacttagcactacggtctagtggtatttctcttcacttgtaagtcagaggtcttaggttcaagtctcg
gcaaatccattgtgtggcttagcctaattctcacacttttagtgtaaatatcgttgtatttaaaaaaaaaactaatttag
gaactttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaa
agcactagggagtgcgtctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggat
ttttgaaagcacttttagccctgtaatataggctctaaatattccaacatttatctaaatttggtttgactggccagatg
ttagacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgtta
gtgcattcgactattattatatccgataggtgaatgttttcttttttgttctacagtttgaagtgtttttaactaacatt
aacaactgtcgtaagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaac
caggtgtttaggtatgccaaaaagg
back to top
>AY555341.1-LFY905
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcactacggtctagtggtatttctcttcacttgtaagtcagaggtcttagattcaagtctcg
gcaaatccattgtgtggcttagcctaattctcactcttttagtgtaaatatcgttgtatttaaaaaaaaaactaatttag
gaactttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaa
agcactcgggagtgcgtctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggat
ttttgaaagcacttttagccctgtaatataggctctaaatattccaacatttatctaaatttggtttgactggccagatg
ttagacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgtta
gtgcattcgactattattatatccgataggtgaatgttttcttttttgttctacagtttgaagtgttttttactaacatt
aacaactgtcgtaagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaac
caggtgtttaggtatgccaaaaagg
back to top
>AY555340.1-LFY904
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcactacggtctagtggtatttctcttcacttgtaagtcagaggtcttagattcaagtctcg
gcaaatccattgtgtggcttagcctaattctcactcttttagtgtaaatatcgttgtatttaaaaaaaaactaatttagg
aactttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaa
gcactcgggagtgcgtctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggatt
tttgaaagcacttttagccctgtaatataggctctaaatattccaacatttatctaaatttggtttgactggccagatgt
tagacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttag
tgcattcgactattattatatccgataggtgaatgttttcttttttgttctacagtttgaagtgttttttactaacatta
acaactgtcgtaagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaacc
aggtgtttaggtatgccaaaaagg
back to top
>AY555339.1-LFY906
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcactacggtctagtggtatttctcttcacttgtaagtcagaggtcttagattcaagtctcg
gcaaatccattgtgtggcttagcctaattctcactcttttagtgtaaatatcgttgtatttaaaaaaaaaaactaattta
ggaactttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaa
aagcactcgggagtgcgtctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtgga
tttttgaaagcacttttagccctgtaatataggctctaaatattccaacatttatctaaatttggtttgactggccagat
gttagacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgtt
agtgcattcgactattattatatccgataggtgaatgttttcttttttgttctacagtttgaagtgttttttactaacat
taacaactgtcgtaagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaa
ccaggtgtttaggtatgccaaaaagg
back to top
>AF487174.1-LFY904
gcggtgagaaatgtcccaccaaggtacagacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcactacggtctagtggtatttctctttacttgtaagtcagaggtcttaggttcaagtctcg
gcaaatccattgtgtggcttagcctaattctcacacttttagtgtaaatatcgttgtatttaaaaaaaaactaatttagg
aactttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaa
gcactcgggagtgcgtctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggatt
tttgaaagcacttttagccccgtaatataggctctaaatattccaacatttatctaaatttggtttgactggccagatgt
tagacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttag
tgcattcgactattattatatccgataggtgaatgttttcttttttgttctacagtttgaagtgtttttaactaacatta
acaactgtcgtaactactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaacc
aggtgtttaggtatgccaaaaagg
back to top
>AF487173.1-LFY905
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ctcaatataaatgttttgagctagctgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcactacggtctagtggtatttctcttcacttgtaagtcagaggtcttaggttcaagtctcg
gcaaatccattgtgtggcttagcctaattctcacacttttagtgtaaatatcgttgtatttaaaaaaaaaactaatttag
gaactttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaa
agcactcgggagtgcgtctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggat
ttttgaaagcacttttagccctgtaatataggctctaaatattccaacatttatctaaatttggtttgactggccagatg
ttagacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgtta
gtgcattcgactattattatatccgataggtgaatgttttcttttttgttctacagtttgaagtgtttttaactaacatt
aacaactgtcgtaactactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaac
caggtgtttaggtatgccaaaaagg
back to top
>AF487172.1-LFY904
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcactacggtctagtggtatttctcttcacttgtaagtcaaaggtcttaggttcaagtctcg
gcaaatccattgtgtggcttagtctaattctcactcttttagtgtaaatatcgttgtatttaaaaaaaaactaatttagg
aactttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaa
gcactcgggagtgcttctccaagaaccgtaaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggatt
tttgaaagcacgtttagccctgtaatataggctctaaatattccaacatttatctaaatttggtttgactggccagatgt
tagacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttag
tgcattcgactattattatatccgataggtgaatgttttcttttttgttctacagtttgaagtgtttttaactaacatta
acaactgtcgtaagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaacc
aggtgtttaggtatgccaaaaagg
back to top
>AF487171.1-LFY904
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcactacggtctagtggtatttctcttcacttgtaagtcaaaggtcttaggttcaagtctcg
gcaaatccattgtgtggcttagtctaattctcactcttttagtgtaaatatcgttgtatttaaaaaaaaactaatttagg
aactttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaa
gcactcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggatt
tttgaaagcacgtttagccctgtaatataggctctaaatattccaacatttatctaaatttggtttgactggccagatgt
tagacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttag
tgcattcgactattattatatccgataggtgaatgttttcttttttgttctacagtttgaagtgtttttaactaacatta
acaactgtcgtaagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaatc
aggtgtttaggtatgccaaaaagg
back to top
>AF487170.1-LFY904
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcactacggtctagtggtatttctcttcacttgtaagtcagaggtcttaggttcaagtctcg
gcaaatccattgtgtggcttagcctaattctcacacttttagtgtaaatatcgttgtatttaaaaaaaaactaatttagg
aactttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaa
gcactcgggagtgcgtctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggatt
tttgaaagcacttttagccctgtaatataggctctaaatattccaacatttatctaaatttggtttgactggccagatgt
tagacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttag
tgcattcgactattattatatccgataggtgaatgttttcttttttgttctacagtttgaagtgtttttaactaacatta
acaactgtcgtaactactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaacc
aggtgtttaggtatgccaaaaagg
back to top
>AF487161.1-LFY1021
gttgcacgtggcaaaaagaacggcctcgattacctcttccatctctacgagcagtgccgtgatttcttgatccaggtcca
gaacattgccaaggagcgcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacg
ataatttctactgtggtaaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattga
agaggcctgctgacaccttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaa
taggtttgttactaatttaggaactttgccacttagcactacggtctagtggtatttctcttcacttgtaagtcagaggt
cttaggttcaagtctcggcaaatccattgtgtggcttagcctaattctcacacttttagtgtaaatatcgttgtatttaa
aaaaaaactaatttaggaactttggattcctttggaattacttctatagaatacacttttacctataaatacttctttta
ctaaaagcacaacaaaagcactcgggagtgcgtctccaagaaccataaaaatgcgttcattattttaaccaaacactatc
agcagcacttgtggatttttgaaagcacttttagccctgtaatataggctctaaatattccaacatttatctaaatttgg
tttgactggccagatgttagacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagt
ctagacccaattgttagtgcattcgactattattatatccgataggtgaatgttttcttttttgttctacagtttgaagt
gtttttaactaacattaacaactgtcgtaactactaacggtgcataattattagacggattaagtatcttacttattata
tatgcaggtgacaaaccaggtgtttaggtatgccaaaaaggcaggggcaagctacatcaac
back to top
>AY555344.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555343.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaagtgtttaggtatgccaaaaagg
back to top
>AY555342.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555341.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555340.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555339.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487174.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487173.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487172.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487171.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaatcaggtgtttaggtatgccaaaaagg
back to top
>AF487170.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AF487161.1-LFY.m1174
gttgcacgtggcaaaaagaacggcctcgattacctcttccatctctacgagcagtgccgtgatttcttgatccaggtcca
gaacattgccaaggagcgcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaaggcagggg
caagctacatcaac
back to top