LFY, LFY (gene) Physocarpus malvaceus

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Physocarpus malvaceus
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAY555358.1-LFYPhysocarpus malvaceusgene
LFYAY555357.1-LFYPhysocarpus malvaceusgene
LFYAY555356.1-LFYPhysocarpus malvaceusgene
LFYAY555355.1-LFYPhysocarpus malvaceusgene
LFYAY555354.1-LFYPhysocarpus malvaceusgene
LFYAY555353.1-LFYPhysocarpus malvaceusgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAY555358.1-LFY.m1Physocarpus malvaceusmRNA
LFYAY555357.1-LFY.m1Physocarpus malvaceusmRNA
LFYAY555356.1-LFY.m1Physocarpus malvaceusmRNA
LFYAY555355.1-LFY.m1Physocarpus malvaceusmRNA
LFYAY555354.1-LFY.m1Physocarpus malvaceusmRNA
LFYAY555353.1-LFY.m1Physocarpus malvaceusmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPhysocarpus malvaceusgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AY555358.1-LFY N/A AY555358.1
gene parsed from NCBI nr database AY555357.1-LFY N/A AY555357.1
gene parsed from NCBI nr database AY555356.1-LFY N/A AY555356.1
gene parsed from NCBI nr database AY555355.1-LFY N/A AY555355.1
gene parsed from NCBI nr database AY555354.1-LFY N/A AY555354.1
gene parsed from NCBI nr database AY555353.1-LFY N/A AY555353.1
mRNA parsed from NCBI nr database AY555358.1-LFY.m1 N/A AY555358.1
mRNA parsed from NCBI nr database AY555357.1-LFY.m1 N/A AY555357.1
mRNA parsed from NCBI nr database AY555356.1-LFY.m1 N/A AY555356.1
mRNA parsed from NCBI nr database AY555355.1-LFY.m1 N/A AY555355.1
mRNA parsed from NCBI nr database AY555354.1-LFY.m1 N/A AY555354.1
mRNA parsed from NCBI nr database AY555353.1-LFY.m1 N/A AY555353.1

Sequence(s):
>AY555358.1-LFY901
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtggcccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcactacggttgagtattatttctcttcacttgtaagtcagaggtcttaggttcaagtctcgg
caagcccattgtgtagcttagtctaattatcacccctttagtgtaaatattgttgtatttaaaaaaaaaaactaatttag
gaactttggattcctttgggattacttctagagaatacacttttacctataaatacttcttttactaaaagcacaacaaa
agcactcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcacttgtggatttt
tgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgtta
gacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtg
cattcgactactattttatcctataggtgaatgttttctttttgttctatagtttgaagtgtttttaactaacattaaca
actgtcataagtactaacggtgcataattattagacggattaggtatcttacttattatatatgcaggtgacaaaccagg
tgtttaggtatgccaaaaagg
back to top
>AY555357.1-LFY901
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcactacggttgagtagtatttctcttcacttgtaagtcagaggtcttaggttcaagtctcgg
caagcctattgtgtagcttagtctaattatcacccctttagtgtaaatattgttgtatttaaaaaaaaaactaatttagg
aactttggattcctttgggattacttctagagaatacacttttacctataaatacttcttttactaaaagcacaacaaaa
gcactagggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcacttgtggattttt
gaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
acagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattattttatccgataggtgaatgttttcttttttgttctacagtttgaagtgtttttaactaacattaaca
actgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccagg
tgtttaggtatgccaaaaagg
back to top
>AY555356.1-LFY902
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcactacggttgagtagtatttctcttcacttgtaagtcagaggtcttaggttcaagtctcgg
caagttcattgtgtgacttagtctaattctcacccctttaatgtaaatatcattgtatttaaaaaaaaaaactaatttag
gaactttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaa
agcactagggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcacttgtggatttt
tgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctgaatttggtttgactggccagatgtta
gacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtg
cattcgactattattttatccgataggtgaatgttttcttttttgttctacagtttgaagtgtttttaactaacattaac
aactgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccag
gtgtttaggtatgccaaaaagg
back to top
>AY555355.1-LFY902
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcactacggttgagtagtatttctcttcacttgtaagtcagaggtcttaggttcaagtctcgg
caagttcattgtgtgacttagtctaattctcacccctttaatgtaaatatcattgtatttaaaaaaaaaaactaatttag
gaactttggattcctttgggattacttctagagaatacacttttacctataaatacttcttttactaaaagcacaacaaa
agcactcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcacttgtggatttt
tgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgtta
gacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtg
cattcgactattattttatcctataggtgaatgttttcttttttgttctatagtttgaagtgtttttaactaacattaac
aactgtcataagtactaacggtgcataattattagacggattaggtatcttacttattatatatgtaggtgacaaaccag
gtgtttaggtatgccaaaaagg
back to top
>AY555354.1-LFY901
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcactacggttgagtagtatttctcttcacttgtaagtcagaggtcttaggttcaagtctcgg
caagttcattgtgtgacttagtctaattctcacccctttaatgtaaatatcgttgtatttaaaaaaaaaactaatttagg
aactttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaa
gcactagggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcacttgtggattttt
gaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
acagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattattttatccgataggtgaatgttttcttttttgttctacagtttgaagtgtttttaactaacattaaca
actgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccagg
tgtttaggtatgccaaaaagg
back to top
>AY555353.1-LFY901
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcactacggttgagtagtatttctcttcacttgtaagtcagaggtcttaggttcaagtctcgg
caagttcattgtgtgacttagtctaattctcacccctttaatgtaaatatcattgtatttaaaaaaaaaactaatttagg
aactttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaa
gcactagggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcacttgtggattttt
gaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
acagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattattttatccgataggtgaatgttttcttttttgttctacagtttgaagtgtttttaactaacattaaca
actgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccagg
tgtttaggtatgccaaaaagg
back to top
>AY555358.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555357.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555356.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555355.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555354.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555353.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top