LFY, LFY (gene) Physocarpus monogynus

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Physocarpus monogynus
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAY555365.1-LFYPhysocarpus monogynusgene
LFYAY555364.1-LFYPhysocarpus monogynusgene
LFYAY555363.1-LFYPhysocarpus monogynusgene
LFYAY555362.1-LFYPhysocarpus monogynusgene
LFYAY555361.1-LFYPhysocarpus monogynusgene
LFYAY555360.1-LFYPhysocarpus monogynusgene
LFYAY555359.1-LFYPhysocarpus monogynusgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAY555365.1-LFY.m1Physocarpus monogynusmRNA
LFYAY555364.1-LFY.m1Physocarpus monogynusmRNA
LFYAY555363.1-LFY.m1Physocarpus monogynusmRNA
LFYAY555362.1-LFY.m1Physocarpus monogynusmRNA
LFYAY555361.1-LFY.m1Physocarpus monogynusmRNA
LFYAY555360.1-LFY.m1Physocarpus monogynusmRNA
LFYAY555359.1-LFY.m1Physocarpus monogynusmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPhysocarpus monogynusgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AY555365.1-LFY N/A AY555365.1
gene parsed from NCBI nr database AY555364.1-LFY N/A AY555364.1
gene parsed from NCBI nr database AY555363.1-LFY N/A AY555363.1
gene parsed from NCBI nr database AY555362.1-LFY N/A AY555362.1
gene parsed from NCBI nr database AY555361.1-LFY N/A AY555361.1
gene parsed from NCBI nr database AY555360.1-LFY N/A AY555360.1
gene parsed from NCBI nr database AY555359.1-LFY N/A AY555359.1
mRNA parsed from NCBI nr database AY555365.1-LFY.m1 N/A AY555365.1
mRNA parsed from NCBI nr database AY555364.1-LFY.m1 N/A AY555364.1
mRNA parsed from NCBI nr database AY555363.1-LFY.m1 N/A AY555363.1
mRNA parsed from NCBI nr database AY555362.1-LFY.m1 N/A AY555362.1
mRNA parsed from NCBI nr database AY555361.1-LFY.m1 N/A AY555361.1
mRNA parsed from NCBI nr database AY555360.1-LFY.m1 N/A AY555360.1
mRNA parsed from NCBI nr database AY555359.1-LFY.m1 N/A AY555359.1

Sequence(s):
>AY555365.1-LFY902
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcactacggttgagtagtatttctcttcacttgtaagttagaggtcttaggttcaagtctcgg
caagcccattgtgtagcttagtctaaatatcacccctttagtgtaaatattgttgtattttaaaaaaaaaacgaatttag
gaactttggattcctttgggattacttctagagactacacttttacctataaatacttcttttactaaaagcacaacaaa
agcactcgggaatgcttctccaagaaccataaaaatgcgttcgttattttaaccaaacactatcagcacttgtggatttt
tgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgtta
gacggtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattggtagtg
cattcgactattattgtattcgataggtgaatgttttcttttttgttctacagtttgaagtgtttttaactaacattaac
aactgtcgtaagtactaacggtgcataattattagacggattaggtatcttacttattatatatgcaggtgacaaaccag
gtgtttaggtatgccaaaaagg
back to top
>AY555364.1-LFY902
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcactacggttgagtattatttctcttcacttgtaagtcagaggtcttaggttcaaatctcgg
caagcccattgtgtagcttagtctaaatatcacccctttagtgtaaatattgttgtattttaaaaaaaaaacgaatttag
gaactttggattcctttgggattacttctagagactacacttttacctataaatacttcttttactaaaagcacaacaaa
agcactcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcacttgtggatttt
tgaaagcgcttttagccctgtaaaataggctctaaatattctaacatttatctaaatttggtttgactggccagatgtta
gacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtg
cattcgactattattttatcctataggtgaatgttttcttttttgttctatagtttgaagtgtttttaactaacattaac
aactgtcataagtactaacggtgcataattattagacggattaggtatcttacttattatatatgcaggtgacaaaccag
gtgtttaggtatgccaaaaagg
back to top
>AY555363.1-LFY901
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtaggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
agaaattttgccacttagcactacggttgagtattatttctcttcacttgtaagtcagaggtcttaggttcaagtctcgg
caagcccattgtgtagcttagtctaattatcacccctttagtgtaaatattgttgtatttaaaaaaaaaaactaatttag
gaactttggattcctttgggattacttctagagaatcacttttacctataaatacttcttttactaaaagcacaccaaaa
gcactcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcacttgtggattttt
gaaagcgctcttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
acagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattattttatcctataggtgaatgttttcttttttgttctatagtttgaagtgtttttaactaacattaaca
actgtcataagtactancggtgcataattattagacggattaggtatcttacttattatatatgcaggtgacaaaccagg
tgtttaggtatgccaaaaagg
back to top
>AY555362.1-LFY900
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcactacggttgagtagtatttctcttcacttgtaagttagaggtcttaggttcaagtctcgg
caagtccattgtgtagcttagtctaattctcacccctttagtgtaaatattgttgtatttaaaaaaaaaactaatttagg
aactttggattcctttgggattacttctagagaatacacttttacctataaatacttcttttactaaaagcacaacaaaa
gcactcgggaatgcttctccaagaaccataaaaatgcgttcattattttaaccaaaaactatcagcacttgtggattttt
gaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
acggtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattattgtatcccataggtgaatgttttcttttttgttctacgtttgaagtgtttttaactaacattaacaa
ttgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccaggt
gtttaggtatgccaaaaagg
back to top
>AY555361.1-LFY901
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtaggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
agaaattttgccacttagcactacggttgagtattatttctcttcacttgtaagtcagaggtcttaggttcaagtctcgg
caagcccattgtgtagcttagtctaattatcacccctttagtgtaaatattggtgtatttaaaaaaaaaaactaatttag
gaactttggattcctttgggattacttctagagaatacacttttacctataaatacttcttttactaaaagcacacaaaa
gcactcgggagtgctcctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcacttgtggattttt
gaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
acagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattattttatcctataggtgaatgttttcttttttgttctatagtttgaagtgtttttaactaacattaaca
actgtcataagtactaacggtgcataattattagacggattaggtatctcacttattatatgtgcaggtgacaaaccagg
tgtttaggtatgccaaaaagg
back to top
>AY555360.1-LFY903
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtaggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
agaaattttgccacttagcactacggttgagtattatttctcttcgcttgtaagtcagaggtcttaggttcaagtctcgg
caagcccattgtgtagcttagtctaattatcacccctttagtgtaaatattgttgtatttaaaaaaaaaaaactaattta
ggaactttggattcctttgggattacttctagagaatacacttttacctataaatacttcttttactaaaagcacaacaa
aagcactcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcacttgtggattt
ttgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggcctgatgtt
agacagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagt
gcattcgactattattttatcctataggtgaatgttttcttttttgttctatagtttgaagtgtttttaactaacattaa
caactgtcataagtactaacggtgcataattattagacggattaggtatcttacttattatatatgcaggtgacaaacca
ggtgtttaggtatgccaaaaagg
back to top
>AY555359.1-LFY900
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcactacggttgagtagtatttctcttcacttgtaagttagaggtcttaggttcaagtctcgg
caagtccattgtgtagcttagtctaattctcacccctttagtgtaaatattgttgtatttaaaaaaaaaactaatttagg
aactttggattcctttgggattacttctagagaatacacttttacctataaatacttcttttactaaaagcacaacaaaa
gcactcgggaatgcttctccaagaaccataaaaatgcgttcattattttaaccaaaaactatcagcacttgtggattttt
gaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
acggtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattactgtatcccataggtgaatgttttcttttttgttctacgtttgaagtgtttttaactaacattaacaa
ttgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccaggt
gtttaggtatgccaaaaagg
back to top
>AY555365.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555364.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555363.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555362.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555361.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555360.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555359.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top