LFY, LFY (gene) Physocarpus opulifolius

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Physocarpus opulifolius
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAY555371.1-LFYPhysocarpus opulifoliusgene
LFYAY555370.1-LFYPhysocarpus opulifoliusgene
LFYAY555369.1-LFYPhysocarpus opulifoliusgene
LFYAY555368.1-LFYPhysocarpus opulifoliusgene
LFYAY555367.1-LFYPhysocarpus opulifoliusgene
LFYAY555366.1-LFYPhysocarpus opulifoliusgene
LFYAY555352.1-LFYPhysocarpus opulifoliusgene
LFYAY555351.1-LFYPhysocarpus opulifoliusgene
LFYAY555350.1-LFYPhysocarpus opulifoliusgene
LFYAY555349.1-LFYPhysocarpus opulifoliusgene
LFYAY555348.1-LFYPhysocarpus opulifoliusgene
LFYAY555347.1-LFYPhysocarpus opulifoliusgene
LFYAY555346.1-LFYPhysocarpus opulifoliusgene
LFYAY555345.1-LFYPhysocarpus opulifoliusgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAY555371.1-LFY.m1Physocarpus opulifoliusmRNA
LFYAY555370.1-LFY.m1Physocarpus opulifoliusmRNA
LFYAY555369.1-LFY.m1Physocarpus opulifoliusmRNA
LFYAY555368.1-LFY.m1Physocarpus opulifoliusmRNA
LFYAY555367.1-LFY.m1Physocarpus opulifoliusmRNA
LFYAY555366.1-LFY.m1Physocarpus opulifoliusmRNA
LFYAY555352.1-LFY.m1Physocarpus opulifoliusmRNA
LFYAY555351.1-LFY.m1Physocarpus opulifoliusmRNA
LFYAY555350.1-LFY.m1Physocarpus opulifoliusmRNA
LFYAY555349.1-LFY.m1Physocarpus opulifoliusmRNA
LFYAY555348.1-LFY.m1Physocarpus opulifoliusmRNA
LFYAY555347.1-LFY.m1Physocarpus opulifoliusmRNA
LFYAY555346.1-LFY.m1Physocarpus opulifoliusmRNA
LFYAY555345.1-LFY.m1Physocarpus opulifoliusmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPhysocarpus opulifoliusgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AY555371.1-LFY N/A AY555371.1
gene parsed from NCBI nr database AY555370.1-LFY N/A AY555370.1
gene parsed from NCBI nr database AY555369.1-LFY N/A AY555369.1
gene parsed from NCBI nr database AY555368.1-LFY N/A AY555368.1
gene parsed from NCBI nr database AY555367.1-LFY N/A AY555367.1
gene parsed from NCBI nr database AY555366.1-LFY N/A AY555366.1
gene parsed from NCBI nr database AY555352.1-LFY N/A AY555352.1
gene parsed from NCBI nr database AY555351.1-LFY N/A AY555351.1
gene parsed from NCBI nr database AY555350.1-LFY N/A AY555350.1
gene parsed from NCBI nr database AY555349.1-LFY N/A AY555349.1
gene parsed from NCBI nr database AY555348.1-LFY N/A AY555348.1
gene parsed from NCBI nr database AY555347.1-LFY N/A AY555347.1
gene parsed from NCBI nr database AY555346.1-LFY N/A AY555346.1
gene parsed from NCBI nr database AY555345.1-LFY N/A AY555345.1
mRNA parsed from NCBI nr database AY555371.1-LFY.m1 N/A AY555371.1
mRNA parsed from NCBI nr database AY555370.1-LFY.m1 N/A AY555370.1
mRNA parsed from NCBI nr database AY555369.1-LFY.m1 N/A AY555369.1
mRNA parsed from NCBI nr database AY555368.1-LFY.m1 N/A AY555368.1
mRNA parsed from NCBI nr database AY555367.1-LFY.m1 N/A AY555367.1
mRNA parsed from NCBI nr database AY555366.1-LFY.m1 N/A AY555366.1
mRNA parsed from NCBI nr database AY555352.1-LFY.m1 N/A AY555352.1
mRNA parsed from NCBI nr database AY555351.1-LFY.m1 N/A AY555351.1
mRNA parsed from NCBI nr database AY555350.1-LFY.m1 N/A AY555350.1
mRNA parsed from NCBI nr database AY555349.1-LFY.m1 N/A AY555349.1
mRNA parsed from NCBI nr database AY555348.1-LFY.m1 N/A AY555348.1
mRNA parsed from NCBI nr database AY555347.1-LFY.m1 N/A AY555347.1
mRNA parsed from NCBI nr database AY555346.1-LFY.m1 N/A AY555346.1
mRNA parsed from NCBI nr database AY555345.1-LFY.m1 N/A AY555345.1

Sequence(s):
>AY555371.1-LFY903
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgacctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcactacggttgagtagtatttctcttcacttgtaagttagargtcttaggttcaagtctcgg
caagcccattgtgtagcttagtctaattctcacctctttagtgtaaatattgttgtatttaaaaaaaaaaaactaattta
ggaactttggattcctttgggattacttctagagaatacacttctacctataaatacttcttttactaaaagcacaacaa
aagcactcgggaatgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcacttgtggattt
ttgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgtt
agacggtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagt
gcattcgactattattttatccgataggtgaatgttttcttttttgttctgcagtttgaagtgttgttaactaacattaa
caattgtcgtaagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaacca
ggtgtttaggtatgccaaaaagg
back to top
>AY555370.1-LFY901
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgacctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgtcactaattt
aggaattttgccacttagcactacggttgagtagtatttctcttcacttgtaagttagaagtcttaggttcaagtctcgg
caagcccattgtgtagcttagtctaattctcacctctttagtgtaaatattggtgtatttaaaaaaaaaactaatttagg
aactttggattcctttgggattacttctagagaatacacttctacctataaatacttcttttactaaaagcacaacaaaa
gcactcgggaatgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcacttgtggattttt
gaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
acggtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattattttatccgataggtgaatgttttcttttttgttctacagtttgaagtgttgttaactaacattaaca
attgtcgtaagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccagg
tgtttaggtatgccaaaaagg
back to top
>AY555369.1-LFY902
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgacctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcactacggttggatagtatttctcttcacttgtaagttagaggttttaggttcaagtctcgg
caagcccattgtgtagcttagtctaattctcacccttttagtataaatattgttgtatttaaaaaaaaaaaactaattta
ggaactttggattcctttgggattacttctagagaatacacttttacctataaatacttcttttactaaaagcacaacaa
aagcactcgggaatgcttctccaagaaccataaaaatgcattcattattttaaccaaacactatcagcacttgtggattt
ttgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgtt
agacggtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaagtctagacccaattgttagtg
cattcgactattattgtatccgataggtgaatgttttcttttttgttctacagtttgaagtgtttttaattaacattaac
aattgtcgtaagtactaacggtgcataataattagacggattaagtatcttacttattatatatgcaggtgacaaaccag
gtgtttaggtatgccaaaaagg
back to top
>AY555368.1-LFY901
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcacggtctagtagtatttctcttcacttgtaagtcagaggttttaggtttaagtctcggca
aatccattgtgtggcttagtctaattctcactcttttagtgtaaatatcgttgtatttaaaaaaaaactaatttaggaac
tttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaagca
ctcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggattttt
gaaagcacttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
gcagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattattgtatcccataggcgaatgttttcttttttgttctacagtttgaagtgtttttaactaacattaaca
attgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccagg
tgtttaggtatgccaaaaagg
back to top
>AY555367.1-LFY901
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcacggtctagtagtatttctcttcacttgtaagtcagaggttttaggtttaagtctcggca
aatccattgtgtggcttagtctaattctcactcttttagtgtaaatatcgttgtatttaaaaaaaaactaatttaggaac
tttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaagca
ctcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggattttt
gaaagcacttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
acagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattattgtatcccataggcgaatgttttcttttttgttctacagtttgaagtgtttttaactaacattaaca
attgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccagg
tgtttaggtatgccaaaaagg
back to top
>AY555366.1-LFY901
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcacggtctagtagtatttctcttcacttgtaagtcagaggttttaggtttaagtctcggca
aatccattgtgtggcttagtctaattctcactcttttagtgtaaatatcgttgtatttaaaaaaaaactaatttaggaac
tttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaagca
ctcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggattttt
gaaagcacttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
acagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattattgtatcccataggcgaatgttttcttttttgttctacagtttgaagtgtttttaactaacattaaca
attgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccagg
tgtttaggtatgccaaaaagg
back to top
>AY555352.1-LFY902
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgacctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaattt
aggaattttgccacttagcactacggttgagtagtatttctcttcacttgtaagttagaggttttaggttcaaatttcgg
caagcccattgtgtagcttagtctaattctcacccttttagtataaatattgttgtatttaaaaaaaaaaactaatttag
gaactttggattcctttgggattacttctagagaatacacttttacctataaatacttcttttactaaaagcacaacaaa
agcactcgggaatgcttctccaagaaccataaaaatgcattcattattttaaccaaacactatcagcacttgtggatttt
tgaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgtta
gacggtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtg
cattcgactattattgtatccgataggcgaatgctttcttttttgttctacagtttgaagtgttgttaactaacattaac
aattgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccag
gtgtttaggtatgccaaaaagg
back to top
>AY555351.1-LFY901
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgtttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaatgggtttgttactaattt
aggaattttgccacttagcactacggttgaatagtatttctcttcacttgtaagttagaggttttaggttcaagtctcgg
caagcccattgtgtagcttagtctaattctcacccttttagtataaatattgttgtatttaaaaaaaaaactaatttagg
aactttggattcctttgggattacttctagagaatacacttttacctataaatacttcttttactaaaagcacaacaaaa
gcactcgggaatgcttctccaagaaccataaaaatgcattcattattttaaccaaacactatcagcacttgtggattttt
gaaagcgcttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
acggtgattgatttcaaacataggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattattgtatccgataggtgaatgttttcttttttgttctacagtttgaagtgtttttaactaacattaaca
attgtcgtaagtactaacggtgcataataattagacggattaagtatcttacttattatatatgcaggtgacaaaccagg
tgtttaggtatgccaaaaagg
back to top
>AY555350.1-LFY901
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcacggtctagtagtatttctcttcacttgtaagtcagaggttttaggtttaagtctcggca
aatccattgtgtggcttagtctaattctcactcttttagtgtaaatatcgctgtatttaaaaaaaaactaatttaggaac
tttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaagca
ctcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggattttt
gaaagcacttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
acagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattattgtatcccataggcgaatgttttcttttttgttatacagtttgaagtgtttttaactaacattaaca
attgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccagg
tgtttaggtatgccaaaaagg
back to top
>AY555349.1-LFY901
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcacggtctagtagtatttctcttcacttgtaagtcagaggttttaggtttaagtctcggca
aatccattgtgtggcttagtctaattctcactcttttagtgtaaatatcggtgtatttaaaaaaaaactaatttaggaac
tttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaagca
ctcgggagtgcttctccaagaaccataaaaatgcgttcattattttgaccaaacactatcagcagcacttgtggattttt
gaaagcacttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
acagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattattgtatcccataggcgaatgttttcttttttgttatacagtttgaagtgtttttaactaacattaaca
attgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccagg
tgtttaggtatgccaaaaagg
back to top
>AY555348.1-LFY901
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatctctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcacggtctagtagtatttctcttcacttgtaagtcagaggttttaggtttaagtctcggca
aatccattgtgtggcttagtctaattctcactcttttagtgtaaatatcgttgtatttaaaaaaaaactaatttaggaac
tttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaagca
ctcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggattttt
gaaagcacttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
acagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattattgtatcccataggcgaatgttttcttttttgttctacagtttgaagtgtttttaactaacattaaca
attgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccagg
tgtttaggtatgccaaaaagg
back to top
>AY555347.1-LFY900
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcacggtctagtagtatttctcttcacttgtaagtcagaggttttaggtttaagtctcggca
aatccattgtgtggcttagtctaattctcactcttttagtgtaaatatcgttgtatttaaaaaaaactaatttaggaact
ttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaagcac
tcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggatttttg
aaagcacttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttaga
cagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgca
ttcgactattattgtatcccataggcgaatgttttcttttttgttatacagtttgaagtgtttttaactaacattaacaa
ttgtcataagtgctaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccaggt
gtttaggtatgccaaaaagg
back to top
>AY555346.1-LFY901
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcacggtctagtagtatttctcttcacttgtaagtcagaggttttaggtttaagtctcggca
aatccattgtgtggcttagtctaattctcactcttttagtgtaaatatcgttgtatttaaaaaaaaactaatttaggaac
tttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaagca
ctcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggattttt
gaaagcacttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
acagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattattgtatcccataggcgaatgttttcttttttgttatacagtttgaagcgtttttaactaacattaaca
attgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccagg
tgtttaggtatgccaaaaagg
back to top
>AY555345.1-LFY901
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaatattgttagaaacgataatttctactgtggt
aaatacttgtaatttacaacctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcctgctgacacc
ttcaatataaatgttttgagctaactgtaggagcccaaattcacaagaaatcaaaatctttaataggtttgttactaatt
taggaactttgccacttagcacggtctagtagtatttctcttcacttgtaagtcagaggttttaggtttaagtctcggca
aatccattgtgtggcttagtctaattctcactcttttagtgtaaatatcgttgtatttaaaaaaaaactaatttaggaac
tttggattcctttggaattacttctatagaatacacttttacctataaatacttcttttactaaaagcacaacaaaagca
ctcgggagtgcttctccaagaaccataaaaatgcgttcattattttaaccaaacactatcagcagcacttgtggattttt
gaaagcacttttagccctgtaaaataggctctaaatattccaacatttatctaaatttggtttgactggccagatgttag
acagtgattgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagtctagacccaattgttagtgc
attcgactattattgtatcccataggcgaatgttttcttttttgttctacagtttgaagtgtttttaactaacattaaca
attgtcataagtactaacggtgcataattattagacggattaagtatcttacttattatatatgcaggtgacaaaccagg
tgtttaggtatgccaaaaagg
back to top
>AY555371.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555370.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555369.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555368.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555367.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555366.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555352.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555351.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555350.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555349.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555348.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555347.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555346.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top
>AY555345.1-LFY.m157
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top