LFY, LFY (gene) Prunus americana

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Prunus americana
Synonym NA
Description NA
Comment LEAFY
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU447296.1-LFYPrunus americanagene
LFYEU050716.1-LFYPrunus americanagene
LFYEU050715.1-LFYPrunus americanagene
LFYEU050714.1-LFYPrunus americanagene
LFYEU050713.1-LFYPrunus americanagene
LFYEU047726.1-LFYPrunus americanagene
LFYEU047725.1-LFYPrunus americanagene
LFYEU047724.1-LFYPrunus americanagene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPrunus americanagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU447296.1-LFY N/A EU447296.1
gene parsed from NCBI nr database EU050716.1-LFY N/A EU050716.1
gene parsed from NCBI nr database EU050715.1-LFY N/A EU050715.1
gene parsed from NCBI nr database EU050714.1-LFY N/A EU050714.1
gene parsed from NCBI nr database EU050713.1-LFY N/A EU050713.1
gene parsed from NCBI nr database EU047726.1-LFY N/A EU047726.1
gene parsed from NCBI nr database EU047725.1-LFY N/A EU047725.1
gene parsed from NCBI nr database EU047724.1-LFY N/A EU047724.1

Sequence(s):
>EU447296.1-LFY659
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaaaaagggggtttgtgaataagatcatatt
ttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtag
aattggataattggttagtttagtgattttcacactcatgttttgttcgtttgcactccgctctttgttatattttgatg
atctatcatctgcttttatttcccaaggtagaaaaacaatataaaagtgcaaacggataaaatcggagtgtgaaagtcgc
cttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttggttgtgtg
aacatgaattattgtgcag
back to top
>EU050716.1-LFY654
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaaargggggtttgtgaataagatcatattt
taatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtaga
attggataattggttagyttagtgattttcacactcatgttttgttcgtttgcaytccgytctttgttatattttgatga
tctatcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcawacsgataraatcggagtgtgaaagtcgcc
acccttrggtatccgatatttgtaaataatgratgatttatcttgtgaccatgacaagtgaattgttgtattttggttgt
gtgaacatgaatta
back to top
>EU050715.1-LFY660
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaagggggtttgtgaataagatcatatttta
atcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaat
tggataattggttagcttagtgattttcacactcatgttttgttcgtttgcactccgctctttgttatattttgatgatc
tatcatctgcttttatttccctaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtgaaagtcaccac
ccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttggttgtgt
gaacatgaattattgtgcag
back to top
>EU050714.1-LFY652
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaagggggtttgtgaataagatcatatttta
atcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaat
tggataattggttagcttagtgattttcacactcatgttttgttcgtttgcaytccgytctttgttatatttkgatgatc
tatcatctgcttttatttcccwaggtagaaaaacaatagaaaagtgcaaacsgataraatcggagtgtgaaagtcrccac
ccttrggtatccgatatttgtaaataatgratgatttatcttgtgaccatgacaagtgaattgttgtattttggttgtgt
gaacatgaatta
back to top
>EU050713.1-LFY663
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaaaargggggtttgtgaataagatcatatt
ttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtag
aattggataattggttagyttagtgattttcacactcatgttttgttcgtttgcactccgytctttgttatattttgatg
atctatcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtgaaagtcgc
cacccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttggttg
tgtggacatgaattattgtgcag
back to top
>EU047726.1-LFY663
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaaaaatggggtttgtgaataagatcatatt
ttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtag
aattggataattggttagtttagtgattttcacactcatgttttgttcgtttgcactccgctctttgttgtattttgatg
atctatcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtgaaagtcgc
cacccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttggttg
tgtgaacatgaattattgtgcag
back to top
>EU047725.1-LFY660
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaaaaaagggggtttgtgaataagatcatat
tttaatcctacgttggtctgaatttgatctgctttgttaggaatatatagtgattccaataatgatgttaatatgacgta
gaattggataattggttagtttagtgattttcacactcatgttttgttcgtttgcactccgctctttgttatattttgat
gatctatcatctgcttttatttcccaaggtagaaaaacaatataaaagtgcaaacggataaaatcggagtgtgaaagtcg
ccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttggttgtgt
gaacatgaattattgtgcag
back to top
>EU047724.1-LFY663
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaaaaagggggtttgtgaataagatcatatt
ttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtag
aattggataattggttagtttagtgattttcacactcatgttttgttcgtttgcactccgttctttgttatattttgatg
atctatcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtgaaagtcgc
cacccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttggttg
tgtggacatgaattattgtgcag
back to top