LFY, LFY (gene) Prunus angustifolia

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Prunus angustifolia
Synonym NA
Description NA
Comment LEAFY
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU447297.1-LFYPrunus angustifoliagene
LFYEU050717.1-LFYPrunus angustifoliagene
LFYEU047727.1-LFYPrunus angustifoliagene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPrunus angustifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU447297.1-LFY N/A EU447297.1
gene parsed from NCBI nr database EU050717.1-LFY N/A EU050717.1
gene parsed from NCBI nr database EU047727.1-LFY N/A EU047727.1

Sequence(s):
>EU447297.1-LFY675
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactac
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctaactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaataaattttttgaaaaaagaaaaagaaaaagggggtttgtgaataagatcat
attttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacg
tagaattggataattggttagcttagtaaaggtagagattttcacactcatgttttgttcgtttgcactccgctctttgt
tatattttgatgatctatcatttgcttttattttccaaggtagaaaaacaatagaaaagtgcgaaccgataaaatcggag
tgtgaaagtcaccacccttaggtatccgatatttgtaaatcatgaatgatttatcttgtgaccatgacaagtgaattgtt
gtattttggttgtgtgaacatgaattattgtgcag
back to top
>EU050717.1-LFY669
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
cttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggctcgaca
gtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctaactctggaccgggtctgaatttttcattgat
tatgtggcagagtaagttcacaataaattttttgaaaaaagaaaaagaaaaagggggtttgtgaataagatcatatttta
atcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaat
tggataattggttagcttagtaaaggtagagattttcacactcatgttttgttcgtttgcactccgctctttgttatatt
ttgatgatctatcatttgcttttattttccaaggtagaaaaacaatagaaaagtgcaaaccgataaaatcggagtgtgaa
agtcaccacccttaggtatccgatatttgtaaatcatgaatgatttatcttgtgaccatgacaagtgaattgttgtattt
tggttgtgtgaacatgaattattgtgcag
back to top
>EU047727.1-LFY669
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
cttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggctcgaca
gtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctaactctggaccgggtctgaatttttcattgat
tatgtggcagagtaagttcacaataaattttttgaaaaaagaaaaagaaaaagggggtttgtgaataagatcatatttta
atcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaat
tggataattggttagcttagtaaaggtagagattttcacactcatgttttgttcgtttgcactccgctctttgttatatt
ttgatgatctatcatttgcttttattttccaaggtagaaaaacaatagaaaagtgcaaaccgataaaatcggagtgtgaa
agtcaccacccttaggtatccgatatttgtaaatcatgaatgatttatcttgtgaccatgacaagtgaattgttgtattt
tggttgtgtgaacatgaattattgtgcag
back to top