LFY, LFY (gene) Prunus armeniaca

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Prunus armeniaca
Synonym LEC14B homolog
Description NA
Comment similar to LEC14B protein cDNA isolated from Lithospermum library
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU050720.1-LFYPrunus armeniacagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYU82760.1-LFY.m1Prunus armeniacamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPrunus armeniacagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU050720.1-LFY N/A EU050720.1
mRNA parsed from NCBI nr database U82760.1-LFY.m1 scaffold_1:10939919..10944531
U82760.1

Sequence(s):
>EU050720.1-LFY651
gtacggagtttacccaacccccgtcttcataacctacatgcatacgctgatttatactgtggtaaatagtaaatactaaa
atagtaacttggcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtgg
cccgacagtttcaattggaaaggcctgctgacagcatcagtataatgtttgagctaactctggcccgggtctgaattttt
cattgatcatgtggcagagttcacaataattgctttgaaaaagatcattgtgaataagatcatattttaatcctactttg
gtctatatttgatctgctttgttagaaatatatagtgattccaacaatgatgttaatatgacgtagaattggataattgg
ttagcttaataaaggtagagattttcacactcgcgttttgttaactccgctctttgttatattttgatgatctatcatct
acttttatttctcaagtagaaaaacaatagaaaagcgcaaacagataaaatcggagtgtgaaagtcgccacccttaggta
tccgatatttgtaaataatgaatcatttatcttgtgaccatgacaagtgaattgttgtattttggttgtgtgaacatgaa
ttattgtgcag
back to top
>U82760.1-LFY.m11428
atgagttacagaacaaggtttggaaaagataatagcgcttgtgatagtggaaatgctgttgaaggttctggttcaagtaa
aggacccaatgaagtatcaaatgattttgatcatgaaattgctcaactcactaagcatagatcaagaccccatcagcttt
tgagccaggacatgcctggaaagtcgaggttactggtttcaacaatgaaaatgttggttggtcgtgaaagtaatcattca
ggacgtgggagattctcgtctgctgacggttgccatgttttgagccggtatctgcccatcaatggtccttggggggtgga
ccagtcaacaagtcctgcttatgtttctcaattttcaaatgatggtttgttttttgttgctggatttcagggcggccata
ttagaatatataatgttgataagggatggaaagttcagaaggacatcctaaccaaaagcttgagatggacaattactgat
acatctctatctccagatcaacgttatcttgtttatgctagcatgacacccattgtcaatattgtcaatgttggatcttc
tatgacagagtcacttgcaaatgttacggaaattcatgaaggtctggatttttctgttggtggtgatgaggacgaatttg
gaattttctcagttagattttcaactgatgggcgagagcttgtagctgcaagtagagatgcttcaatatatgtttatgat
ctccaagcaaataaagttaacctccgaataccagcacactcgtctgatgtaaacactgtatgctttgcggatgagactgg
acatctcatatattctggcagtgacgataatctctgtaaggtttgggatagacgctgctttaatcacaaaggacagccag
ctggggtcctgatgggacatcttgaaggtgttacatttattgatagtaggggagatgggcgttacttcatatcaaatggg
aaggaccagactacccaactctgggatataagaaagatgtcctctagagccatgtacagcccaaggcttagagatcatga
ctgggattacagatggatggagtacccagctcatgcaaaaactttgaaacatccaaatgatcagtcactggctacatata
gaggtcatggagtcctgcgtactttaattcgctgttacctttctccagcatatagtactggacaaaagtacatctacact
ggatctagtgatcattgtgtctatatatatgatctggtgaccggtgctcaagttgcgagactcaaccatcacgaaggacc
tgtaagagactgtagttggcatcctctctatccgatgttggtcagctcttcttgggatgggacgattgccagatgggaat
ttcctggggatgaccaagtacccaccctggagaggccgagagcgcgccggaaggagaggctactataa
back to top