LFY, LFY (gene) Prunus hortulana

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Prunus hortulana
Synonym NA
Description NA
Comment LEAFY
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU050724.1-LFYPrunus hortulanagene
LFYEU047729.1-LFYPrunus hortulanagene
LFYEU047728.1-LFYPrunus hortulanagene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPrunus hortulanagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU050724.1-LFY N/A EU050724.1
gene parsed from NCBI nr database EU047729.1-LFY N/A EU047729.1
gene parsed from NCBI nr database EU047728.1-LFY N/A EU047728.1

Sequence(s):
>EU050724.1-LFY911
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaattacaa
atttataaataaacccaatcctagatatgaatttataaaaaaacacaacactatttaaaacatagaaacacacccaaaat
caacccaaaaatcaacaattgtatattttttaggtgtgtttataaatgggttttgagtgtttaatacatgggttttaggt
gtgtttataaagtgtttttcatgttgggtttttttataatttcagcccctattttgagtgtattagtgaaacttccatag
taaatactaatagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattaca
atctagtggctcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtc
tgaatttttcattgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaaaagggggtttgtgaataa
gatcatattttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaat
atgacgtagaattggatattggttagcttagtgattttcacactcatgttttgttcgtctgcactccgttctttgttata
ttttgatgatctatcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtg
aaagtcgccacccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccaggacaagtgaattgttgtat
tttggttgtgtggacatgaattattgtgcag
back to top
>EU047729.1-LFY911
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaattacaa
atttataaataaacccaatcctagacatgaatttataaaaaaacgcaacactatttaaaacatagaaacacacccaaaat
caacccaaaaatcaacaattgtatattttttaggtgtgtttataaatgagttttgagtgtttaatacatgggttttgggt
gtgtttataaagtgtttttcatgttgggtttttttataatttcagcccctattttgagtgtattagtgaaactcccatag
taaatactaatagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattaca
atctagtggctcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtc
tgaatttttcattgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaaagggggtttgtgaataag
atcatattttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaata
tgacgtagaattggataattggttagcttagtgattttcacactcatgttttgttcgtttgcactccgttctttgttata
ttttgatgatctatcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtg
aaattcgccacccttaggtatccgatatttataaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtat
tttggttgtgtggacatgaattattgtgcag
back to top
>EU047728.1-LFY912
gtacggagtttacccaacctcccgtcttcataacctaaatgcatatgctgatttatactgtggtaaatagtacattacaa
atttataaataaacccaatcctagacatgaatttataaaaaaacgcaacactatttaaaacatagaaacacacccaaaat
taacccaaaaatcaacaattgtatattttttaggtgtgtttataaatgggttttgagtgtttaatacatgggttttgggt
gtgtttataaagtgtttttcatgttgggtttttttataatttcagctcctattttgagtgtattagtgaaactacaatag
taaatactaatagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattaca
atctagtggctcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtc
tgaatttttcattgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaaaaaagggggtttgtgaat
aagatcatattttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgtta
atatgacgtagaattggataattggttagcttagtgattttcacacatgttttgttcgtctgcactccgttctttgttat
attttgatgatctatcatctgcttttatttctcaaggtagaaaaacaatagaaaagtgcaaacggataaaattggagtgt
gaaagtcgccacccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccatgacaagtgaattgttgta
ttttggttgtgtggacatgaattattgtgcag
back to top