LFY, LFY (gene) Prunus mexicana

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Prunus mexicana
Synonym NA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU050729.1-LFYPrunus mexicanagene
LFYEU050728.1-LFYPrunus mexicanagene
LFYEU050727.1-LFYPrunus mexicanagene
LFYEU050726.1-LFYPrunus mexicanagene
LFYEU050719.1-LFYPrunus mexicanagene
LFYEU050718.1-LFYPrunus mexicanagene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPrunus mexicanagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU050729.1-LFY N/A EU050729.1
gene parsed from NCBI nr database EU050728.1-LFY N/A EU050728.1
gene parsed from NCBI nr database EU050727.1-LFY N/A EU050727.1
gene parsed from NCBI nr database EU050726.1-LFY N/A EU050726.1
gene parsed from NCBI nr database EU050719.1-LFY N/A EU050719.1
gene parsed from NCBI nr database EU050718.1-LFY N/A EU050718.1

Sequence(s):
>EU050729.1-LFY661
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaataaattttttgaaaaaaaaaaaaatggggtttgtgaataagatcatatttt
aatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaa
ttggataattggttagcttagtgattttcacactcatgttttgttcgtttgcattccgttctttgttatattttgatgat
ctatgatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtgaaagtcgcca
ccyttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttggttgtg
tggacatgaattattgtgcag
back to top
>EU050728.1-LFY662
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaakaaattttttgaaaaaaaaaaaaaakggggtttgtgaataagatcatattt
taatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtaga
attggataattggttagyttagtgattttcacactcatgttttgttcgtttgcaytccgytctttgttatattttgatga
tctatsatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtgaaagtcgcc
acccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttggttgt
gtgaacatgaattattgtgcag
back to top
>EU050727.1-LFY664
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaakaaattttttgaaaawaaaaawaaaaatggggtttgtgaataagatcatat
tttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgta
gaattggataattggttagtttagtgattttcacactcatgttttgttcgtttgcactccgctctttgttatattttgat
gatctatcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtgaaagtcg
ccacccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttggtt
gtgtgracatgaattattgtgcag
back to top
>EU050726.1-LFY663
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaataaattttttgaaaaaaaaaaaaaaatggggtttgtgaataagatcatatt
ttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtag
aattggataattggttagcttagtgattttcacactcatgttttgttcgtttgcattccgttctttgttatattttgatg
atctatgatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtgaaagtcgc
cacccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttggttg
tgtggacatgaattattgtgcag
back to top
>EU050719.1-LFY662
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaakaaattttttgaaaaaaaaaaaaaakggggtttgtgaataagatcatattt
taatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtaga
attggataattggttagyttagtgattttcacactcatgttttgttcgtttgcaytccgytctttgttatattttgatga
tctatsatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtgaaagtcgcc
acccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttggttgt
gtgracatgaattattgtgcag
back to top
>EU050718.1-LFY664
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaataaaaakggggtttgtgaataagatcatat
tttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgta
gaattggataattggttagtttagtgattttcacactcatgttttgttcgtttgcactccgctctttgttatattttgat
gatctatcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtgaaagtcg
ccacccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttggtt
gtgtgaacatgaattattgtgcag
back to top