LFY, LFY (gene) Prunus munsoniana

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Prunus munsoniana
Synonym NA
Description NA
Comment LEAFY
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU447298.1-LFYPrunus munsonianagene
LFYEU050730.1-LFYPrunus munsonianagene
LFYEU047745.1-LFYPrunus munsonianagene
LFYEU047744.1-LFYPrunus munsonianagene
LFYEU047733.1-LFYPrunus munsonianagene
LFYEU047732.1-LFYPrunus munsonianagene
LFYEU047731.1-LFYPrunus munsonianagene
LFYEU047730.1-LFYPrunus munsonianagene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPrunus munsonianagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU447298.1-LFY N/A EU447298.1
gene parsed from NCBI nr database EU050730.1-LFY N/A EU050730.1
gene parsed from NCBI nr database EU047745.1-LFY N/A EU047745.1
gene parsed from NCBI nr database EU047744.1-LFY N/A EU047744.1
gene parsed from NCBI nr database EU047733.1-LFY N/A EU047733.1
gene parsed from NCBI nr database EU047732.1-LFY N/A EU047732.1
gene parsed from NCBI nr database EU047731.1-LFY N/A EU047731.1
gene parsed from NCBI nr database EU047730.1-LFY N/A EU047730.1

Sequence(s):
>EU447298.1-LFY674
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactac
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctaactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaataaattttttgaaaaaagaaaaagaaaaagggggtttgtgaataagatcat
attttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacg
tagaattggataattggttagctagtaaaggtagagattttcacactcatgttttgttcgtttgcactccgctctttgtt
atattttgatgatctatcatttgcttttattttccaaggtagaaaaacaatagaaaagtgcgaaccgataaaatcggagt
gtgaaagtcaccacccttaggtatccgatatttgtaaatcatgaatgatttatcttgtgaccatgacaagtgaattgttg
tattttggttgtgtgaacatgaattattgtgcag
back to top
>EU050730.1-LFY669
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
cttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggctcgaca
gtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctaactctggaccgggtctgaatttttcattgat
tatgtggcagagtaagttcacaataaattttttgaaaaaagaaaaagaaaaagggggtttgtgaataagatcatatttta
atcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaat
tggataattggttagcttagtaaaggtagagattttcacactcatgttttgttcgtttgcactccgctctttgttatatt
ttgatgatctatcatttgcttttattttccaagatagaaaaacaatagaaaagtgcgaaccgataaaatcggagtgtgaa
agtcaccacccttaggtatccgatatttgtaaatcatgaatgatttatcttgtgaccatgactagtgaattgttgtattt
tggttgtgtgaacatgaattattgtgcag
back to top
>EU047745.1-LFY911
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaattacaa
atttataaataaacccaatcctagatatgaatttataaaaaaacacaacactatttaaaacatagaaatacacccaaaat
caacccaaaaatcaacaattgtatattttttaggtgtgtttataaatgggttttgagtgtttaatacatgggttttaggt
gtgtttataaagtgtttttcatgttgggtttttttataatttcagctcctattttgagtgtattagtgaaactcccatag
taaatactaatagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattaca
atctagtggctcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtc
tgaatttttcattgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaaaggggggtttgtgaataa
gatcatattttaatcctacgttggtctgaatttgatctgctttgtttgaaatatatagtgattccaataatgatgttaat
atgacgtagaattggatattggttagcttagtgattttcacactcatgttttgttcgtctgcactccgttctttgttata
ttttgatgatctatcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtg
aaagtcgccacccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccaggacaagtgaattgttgtat
tttggttgtgtggacatgaattattgtgcag
back to top
>EU047744.1-LFY669
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
cttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggctcgaca
gtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctaactctggaccgggtctgaatttttcattgat
tatgtggcagagtaagttcacaataaattttttgaaaaaagaaaaagaaaaagggggtttgtgaataagatcatatttta
atcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaat
tggataattggttagcttagtaaaggtagagattttcacactcatgttttgttcgtttgcactccgctctttgttatatt
ttgatgatctatcatttgcttttattttccaagatagaaaaacaatagaaaagtgcgaaccgataaaatcggagtgtgaa
agtcaccacccttaggtatccgatatttgtaaatcatgaatgatttatcttgtgaccatgactagtgaattgttgtattt
tggttgtgtgaacatgaattattgtgcag
back to top
>EU047733.1-LFY667
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
cttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggctcgaca
gtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctaactctggaccgggtctgaatttttcattgat
tatgtggcagagtaagttcacaataaattttttgaaaaaagaaaaagaaaaagggggtttgtgaataagatcatatttta
atcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaat
tggataattggttagcttagtaaaggtagagattttcactcatgttttgttcgtttgcactccgctctttgttatatttt
gatgatctatcatttgcttttgttttccaaggtagaaaaacaatagaaaagtgcaaaccgataaaatcggagtgtgaaag
tcaccacccttaggtatccgatatttgtaaatcatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttg
gttgtgtgaacatgaattattgtgcag
back to top
>EU047732.1-LFY669
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
cttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggctcgaca
gtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctaactctggaccgggtctgaatttttcattgat
tatgtggcagagtaagttcacaataaattttttgaaaaaagaaaaagaaaaagggggtttgtgaataagatcatatttta
atcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaat
tggataattggttagcttagtaaaggtagagattttcacactcatgttttgttcgtttgcactccgctctttgttatatt
ttgatgatctatcatttgcttttattttccaagatagaaaaacaatagaaaagtgcgaaccgataaaatcggagtgtgaa
agtcaccacccttaggtatccgatatttgtaaatcatgaatgatttatcttgtgaccatgactagtgaattgttgtattt
tggttgtgtgaacatgaattattgtgcag
back to top
>EU047731.1-LFY660
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaagggggtttgtgaataagatcatatttta
atcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaat
tggataattggttagcttagtgattttcacactcatgttttgttcgtttgcactccgctctttgttatattttgatgatc
tatcatctgcttttatttccctaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtgaaagtcaccac
ccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttggttgtgt
gaacatgaattattgtgcag
back to top
>EU047730.1-LFY912
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaattacaa
atttataaataaacccaatcctagatatgaatttataaaaaaacacaacactatttaaaacatagaaacacacccaaaat
caacccaaaaatcaacaattgtatattttttaggtgtgtttataaatgggttttgagtgtttaatacatgggttttaggt
gtgtttataaagtgtttttcatgttgggtttttttataatttcagctcctattttgagtgtattagtgaaactcccatag
taaatactaatagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattaca
atctagtggctcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtc
tgaatttttcattgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaaaaggggggtttgtgaata
agatcatattttaatcctacgttggtctgaatttgatctgctttgtttgaaatatatagtgattccaataatgatgttaa
tatgacgtagaattggatattggttagcttagtgattttcacactcatgttttgttcgtctgcactccgttctttgttat
attttgatgatctatcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgt
gaaagtcgccacccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccaggacaagtgaattgttgta
ttttggttgtgtggacatgaattattgtgcag
back to top