LFY, LFY (gene) Prunus murrayana

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Prunus murrayana
Synonym NA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU050734.1-LFYPrunus murrayanagene
LFYEU050733.1-LFYPrunus murrayanagene
LFYEU050732.1-LFYPrunus murrayanagene
LFYEU050731.1-LFYPrunus murrayanagene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPrunus murrayanagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU050734.1-LFY N/A EU050734.1
gene parsed from NCBI nr database EU050733.1-LFY N/A EU050733.1
gene parsed from NCBI nr database EU050732.1-LFY N/A EU050732.1
gene parsed from NCBI nr database EU050731.1-LFY N/A EU050731.1

Sequence(s):
>EU050734.1-LFY908
gtacggagtttacccaacctcccgtcttcataacctaaatgcatatgctgatttatactgtggtaaatagtacattacaa
atttataaataaacycaatcctagacatgaatttataaaaaaacgcaacactatttaaaacatagaaacacacccaaaat
yaacccaaaaatcaacaattgtatattytttaggtgtgtttataaatgrgttttgagtrtttaatacatgggttttgggt
gtrtttataaagtgtttttcatgttgggtttttttataatttcagcccctattttgagtgtattagtgaaactccmatag
taaatactaatagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattaca
atctagtggctcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtc
tgaatttttcattgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaagggggtttgtgaataaga
tcatattttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatat
gacgtagaattggataattggtwagcttagtgattttcacacatgttttgttcgtctgcactccgttctttgttatattt
tgatgatctatcatctgcttttatttctcaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtgaaa
gtcgccacccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtatttt
ggttgtgtggacatgaattattgtgcag
back to top
>EU050733.1-LFY663
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggc
tcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtctgaatttttc
attgattatgtggccgagtaagttcacaagaaattttttgaaaaaaaaaaaaaaagggggtttgtgaataagatcatatt
ttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtag
aattggataattagttagcttagtgattttcacactcatgttttgttcgtctgcactccgttctttgttatattttgatg
atctatcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaaccgataaaatcggagtgtgaaagtcgc
cacccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccaggacaagtgaattgttgtattttggttg
tgtggamatgaattattgtgcag
back to top
>EU050732.1-LFY908
gtacggagtttacccaacctcccgtcttcataacctaaatgcatatgctgatttatactgtggtaaatagtacattacaa
atttataaataaacccaatcctagacatgaatttataaaaaaacgcaacactatttaaaacatagaaacacacccaaaat
caacccaaaaatcaacaattgtatattctttaggtgtgtttataaatgggttttgagtgtttaatacatgggttttgggt
gtgtttataaagtgtttttcatgttgggtttttttataatttcagcccctattttgagtgtattagtgaaactccaatag
taaatactaatagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattaca
atctagtggctcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtc
tgaatttttcattgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaagggggtttgtgaataaga
tcatattttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatat
gacgtagaattggataattggttagcttagtgattttcacacatgttttgttcgtctgcactccgttctttgttatattt
tgatgatctatcatctgcttttatttcycaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtgaaa
gtcgccacccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccakgacaagtgaattgttgtatttt
ggttgtgtggamatgaattattgtgcag
back to top
>EU050731.1-LFY914
gtacggagtttacccaacctcccgtcttcataacctaaatgcatatgctgatttatactgtggtaaatattacattacaa
atttataaataaacccaatcctagatatgaatttataaaaaaacgcaacactatttaaaacatagaaacacacccaaaat
caacccaaaaatcaacaattgtatattttttaggtgtgtttataaatgggttttgagtgtttaatacatgggttttgggt
gtgtttataaagtgtttttcatattgggtttttttataatttcagcccctattttgagtgtattagtgaaactcccatag
taaatactaatagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattaca
atctagtggctcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtc
tgaatttttcattgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaaaaagggggtttgtgaata
agatcatattttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaa
tatgacgtagaattggataattggttagcttagtgattttcacactcatgttttgttcgtttgcactccgttctttgtta
tattttgatgatctatcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtg
tgaaattcgcccacccttaggtatccgatatttataaataatgaatgatttatcttgtgaccatgacaagtgaattgttg
tattttggttgtgtggacatgaattattgtgcag
back to top