LFY, LFY (gene) Prunus persica

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Prunus persica
Synonym LEAFY
Description NA
Comment flower meristem protein
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEF175869.1-LFY.m1Prunus persicamRNA
LFYEU375891.1-LFY.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPrunus persicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EF175869.1-LFY.m1 scaffold_5:13116755..13118941
EF175869.1
mRNA parsed from NCBI nr database EU375891.1-LFY.m1 scaffold_5:13116755..13118941
EU375891.1

Sequence(s):
>EF175869.1-LFY.m11248
atggatccagacgccttctcagcgagcctcttcaagtgggacctacgaggcatggttgttccgccgagccgggctcagct
agaagccgccgtgacgcctcaagctgccgctgcagctgcggcttacgctgctgtgaggccgcagagagagctcggagggc
ttgaggacttgttccaggcttatggggtcagatactacacggcagcgaagatagccgagctcggctttactgtgaacacc
cttttggatatgagggacggtgagcttgacgacatgatgagtagcctctctcagatattcaggtgggatttgcttgtggg
tgagaggtacggtatcaaagccgccgtcagagcagagcgtcgtcgcctcgatgacgaggactcgaggcggcgccacacct
tctccggcgacaccaccaccaatgccctagatgctctctcccaagaagggttgtcggaggagccggtgcaacaagagaag
gagatggtggggagcggcggaggggccgcctgggaagtggtggcggcggcggcaggggagaagcggaagaagcagcgaag
gacgaggaaggggcaatataggaatttcaatggcataagaagggggcataataataatgatcataatgagggtgtggaca
acggggacgacaacgacttggacgacatgaatgggcacgggaacgggggaggaggggggttgctgagcgagagacagagg
gagcacccgttcattgtgactgagcctggggaggtggcacgtggcaaaaagaacggcctagattacctcttccatctcta
cgagcagtgccgtgatttcttgatccaggtccaaaacattgcaaaggagcgcggtgaaaaatgtccaaccaaggtaacaa
accaagtgtttaggtttgcaaaaaaggcaggggcaagctacatcaacaagcccaagatgcgacactacgtgcattgctat
gcgctgcattgcttggacgaggaggcctccaatgcactgaggagagtttttaaggagagaggcgaaaatgtgggggcctg
gagacatgcatgttacaagcctcttgtggccatcgcagcaggccaaggctgggacattgatgccatcttcaattctcatc
cccgcctctccatttggtatgttcccaccaaggtccggcagctttgtcacactgagcgtaacaatgccacggcctctagc
tctgcctctggtggtgacggtggtggccgtgatcacctaccctactga
back to top
>EU375891.1-LFY.m11248
atggatccagacgccttctcagcgagcctcttcaagtgggacctacgaggcatggttgttccgccgagccgggctcagct
agaagccgccgtgacgcctcaagctgccgctgcagctgcggcttacgctgctgtgaggccgcagagagagctcggagggc
ttgaggacttgttccaggcttatggggtcagatactacacggcagcgaagatagccgagctcggctttactgtgaacacc
cttttggatatgagggacggtgagcttgacgacatgatgagtagcctctctcagatagtcaggtgggatttgcttgtggg
tgagaggtacggtatcaaagccgccgtcagagcagagcgtcgtcgcctcgatgacgaggactcgaggcggcgccacacct
tctccggcgacaccaccaccaatgccctagatgctctctcccaagaagggttgtcggaggagccggtgcaacaagagaag
gagatggtggggagcggcggaggggccgcctgggaagtggtggcggcggcggcaggggagaagcggaagaagcagcgaag
gacgaggaaggggcaatataggaatttcaatggcataagaagggggcataataataatgatcataatgagggtgtggaca
acggggacgacaacgacttagacgacatgaatgggcacgggaacgggggaggaggggggttgctgagcgagagacagagg
gagcacccgttcattgtgactgagcctggggaggtggcacgtggcaaaaagaacggcctagattacctcttccatctcta
cgagcagtgccgtgatttcttgatccaggtccaaaacattgcaaaggagcgcggtgaaaaatgtccaaccaaggtaacaa
accaagtgtttaggtttgcaaaaaaggcaggggcaagctacatcaacaagcccaagatgcgacactacgtgcattgctat
gcgctgcattgcttggacgaggaggcctccaatgcactgaggagagtttttaaggagagaggcgaaaatgtgggggcctg
gaaacatgcatgttacaagcctcttgtggccatcgcagcaggccaaggctgcgacattgatgccatcttcaattctcatc
cccgcctctccatttggtacgttcccaccaagctccggcagctttgtcacactgagcgtaacaatgccacggcctctagc
tctgcctctggtggtgacggtggtggccgtgatcacctaccctactga
back to top