LFY, LFY (gene) Prunus rivularis

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Prunus rivularis
Synonym NA
Description NA
Comment LEAFY
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU447301.1-LFYPrunus rivularisgene
LFYEU447300.1-LFYPrunus rivularisgene
LFYEU447299.1-LFYPrunus rivularisgene
LFYEU050738.1-LFYPrunus rivularisgene
LFYEU047743.1-LFYPrunus rivularisgene
LFYEU047742.1-LFYPrunus rivularisgene
LFYEU047741.1-LFYPrunus rivularisgene
LFYEU047740.1-LFYPrunus rivularisgene
LFYEU047739.1-LFYPrunus rivularisgene
LFYEU047738.1-LFYPrunus rivularisgene
LFYEU047737.1-LFYPrunus rivularisgene
LFYEU047736.1-LFYPrunus rivularisgene
LFYEU047735.1-LFYPrunus rivularisgene
LFYEU047734.1-LFYPrunus rivularisgene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPrunus rivularisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU447301.1-LFY N/A EU447301.1
gene parsed from NCBI nr database EU447300.1-LFY N/A EU447300.1
gene parsed from NCBI nr database EU447299.1-LFY N/A EU447299.1
gene parsed from NCBI nr database EU050738.1-LFY N/A EU050738.1
gene parsed from NCBI nr database EU047743.1-LFY N/A EU047743.1
gene parsed from NCBI nr database EU047742.1-LFY N/A EU047742.1
gene parsed from NCBI nr database EU047741.1-LFY N/A EU047741.1
gene parsed from NCBI nr database EU047740.1-LFY N/A EU047740.1
gene parsed from NCBI nr database EU047739.1-LFY N/A EU047739.1
gene parsed from NCBI nr database EU047738.1-LFY N/A EU047738.1
gene parsed from NCBI nr database EU047737.1-LFY N/A EU047737.1
gene parsed from NCBI nr database EU047736.1-LFY N/A EU047736.1
gene parsed from NCBI nr database EU047735.1-LFY N/A EU047735.1
gene parsed from NCBI nr database EU047734.1-LFY N/A EU047734.1

Sequence(s):
>EU447301.1-LFY669
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
cttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggctcgaca
gtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctaactctggaccgggtctgaatttttcattgat
tatgtggcagagtaagttcacaataaattttttgaaaaaagaaaaagaaaaagggggtttgtgaataagatcatatttta
atcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaat
tggataattggttagcttagtaaaggtagagattttcacactcatgttttgttcgtttgcactccgctctttgttatatt
ttgatgatctatcatttgcttttattttccaagatagaaaaacaatagaaaagtgcgaaccgataaaatcggagtgtgaa
agtcaccacccttaggtatccgatatttgtaaatcatgaatgatttatcttgtgaccatgactagtgaattgttgtattt
tggttgtgtgaacatgaattattgtgcag
back to top
>EU447300.1-LFY912
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaattacaa
atttataaataaacccaatcctagatatgaatttataaaaaaacacaacactatttaaaacatagaaacacacccaaaat
caacccaaaaatcaacaattgtatattttttaggtgtgtttataaatgggttttgagtgtttaatacatgggttttaggt
gtgtttataaagtgtttttcatgttgggtttttttataatttcagctcctattttgagtgtattagtgaaactcccatag
taaatactaatagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattaca
atctagtggctcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtc
tgaatttttcattgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaaaaggggggtttgtgaata
agatcatattttaatcctacgttggtctgaatttgatctgctttgtttgaaatatatagtgattccaataatgatgttaa
tatgacgtagaattggatattggttagcttagtgattttcacactcatgttttgttcgtctgcactccgttctttgttat
attttgatgatctatcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgt
gaaagtcgccacccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccaggacaagtgaattgttgta
ttttggttgtgtggacatgaattattgtgcag
back to top
>EU447299.1-LFY669
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
cttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggctcgaca
gtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctaactctggaccgggtctgaatttttcattgat
tatgtggcagagtaagttcacaataaattttttgaaaaaagaaaaagaaaaagggggtttgtgaataagatcatatttta
atcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaat
tggataattggttagcttagtaaaggtagagattttcacactcatgttttgttcgtttgcactccgctctttgttatatt
ttgatgatctatcatttgcttttattttccaaggtagaaaaacaatagaaaagtgcaaaccgataaaatcggagtgtgaa
agtcaccacccttaggtatccgatatttgtaaatcatgaatgatttatcttgtgaccatgacaagtgaattgttgtattt
tggttgtgtgaacatgaattattgtgcag
back to top
>EU050738.1-LFY912
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaattacaa
atttataaataaacccaatcctagatatgaatttataaaaaaacacaacactatttaaaacatagaaacacacccaaaat
caacccaaaaatcaacaattgtatattttttaggtgtgtttataaatgggttttgagtgtttaatacatgggttttaggt
gtgtttataaagtgtttttcatgttgggtttttttataatttcagctcctattttgagtgtattagtgaaactcccatag
taaatactaatagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattaca
atctagtggctcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtc
tgaatttttcattgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaaaaggggggtttgtgaata
agatcatattttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaa
tatgacgtagaattggatattggttagcttagtgattttcacactcatgttttgttcgtctgcactccgttctttgttat
attttgatgatctatcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgt
gaaagtcgccacccttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccaggacaagtgaattgttgta
ttttggttgtgtggacatgaattattgtgcag
back to top
>EU047743.1-LFY661
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
cttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggctcgaca
gtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctaactctggaccgggtctgaatttttcattgat
tatgtggcagagtaagttcacaataaattttttgaaaaaagaaaaagaaaaagggggtttgtgaataagatcatatttta
atcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaat
tggataattggttagcttagtgattttcacactcatgttttgttcgtttgcactccgttctttgttatattttgatgatc
tatcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtgaaattcgccca
cccttaggtatccgatatttataaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttggttgtg
tggacatgaattattgtgcag
back to top
>EU047742.1-LFY925
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaattacaa
atttataaataaacccaatcctagatatgaatttataaaaaaacacaacactatttaaaacatagaaacacacccaaaat
caacccaaaaatcaacaattgtatattttttaggtgtgtttataaatgggttttgagtgtttaatacatgggttttaggt
gtgtttataaagtgtttttcatgttgggtttttttataatttcagctcctattttgagtgtattagtgaaactcccatag
taaatactaatagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattaca
atctagtggctcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctaactctggaccgggtc
tgaatttttcattgattatgtggcagagtaagttcacaataaattttttgaaaaaagaaaaagaaaaagggggtttgtga
ataagatcatattttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgt
taatatgacgtagaattggataattggttagcttagtaaaggtagagattttcacactcatgttttgttcgtttgcactc
cgctctttgttatattttgatgatctatcatttgcttttattttccaagatagaaaaacaatagaaaagtgcgaaccgat
aaaatcggagtgtgaaagtcaccacccttaggtatccgatatttgtaaatcatgaatgatttatcttgtgaccatgacta
gtgaattgttgtattttggttgtgtgaacatgaattattgtgcag
back to top
>EU047741.1-LFY658
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
cttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggctcgaca
gtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctaactctggaccgggtctgaatttttcattgat
tatgtggcagagtaagtccacaataaatttttgaaaaaagaaaaagaaaaagggggtttgtgaataagatcatattttaa
tcctacgttggtctgaatttgatctgctttgtttgaaatatatagtgactccaataatgatgttaatatgacgtagaatt
ggatattggttagcttagtgattttcacactcatgttttgttcgtctgcactccgttctttgttatattttgatgatcta
tcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtgaaagtcgccaccc
ttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccaggacaagtgaattgttgtattttggttgtgtgg
acatgaattattgtgcag
back to top
>EU047740.1-LFY913
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaattacaa
atttataaataaatccaatcctagacatgaatttataaaaaaacgcaacactatttaaaacatagaaacacacccaaaat
caacaattgtatattttttaggtgtgtttataaatgggttttgagtgtttaatacatgggttttaggtgtgtttataaag
tgtttttcatgttgggtttttttataatttcagcccctattttgagtgtattagtgaaactcccatagtaaatactaata
gtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggctc
gacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctaactctggaccgggtctgaatttttcat
tgattatgtggcagagtaagttcacaataaattttttgaaaaaagaaaaagaaaaagggggtttgtgaataagatcatat
tttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgta
gaattggataattggttagcttagtaaaggtagagattttcacactcatgttttgttcgtttgcactccgctctttgtta
tattttgatgatctatcgtttgcttttattttccaaggtagaaaaacaatagaaaagtgcaaaccgataaaatcggagtg
tgaaagccaccacccttaggtatccgatatttgtaaatcatgaatgatttatcttgtgaccatgacaagtgaattgttgt
attttggttgtgtgaacatgaattattgtgcag
back to top
>EU047739.1-LFY907
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaattacaa
atttataaataaatccaatcctagacatgaatttataaaaaaacgcaacactatttaaaacatagaaacacacccaaaat
caacaattgtatattttttaggtgtgtttataaatgggttttgagtgtttaatacatgggttttaggtgtgtttataaag
tgtttttcatgttgggtttttttataatttcagcccctattttgagtgtattagtgaaactcccatagtaaatactaata
gtaacttgtcgcatggactatcatacttggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggctc
gacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctgggccgggtctgaatttttcat
tgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaagggggtttgtgaataagatcatattttaat
cctacgttggcctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaattg
gataattggttagcttagtaaaggtagagattttcacactcatgttttgttcgtttgcactccgctctttgttatatttt
gatgatctatcatttgcttttattttccaaggtagaaaaacaatagaaaagtgcaaaccgataaaatcggagtgtgaaag
tcaccacccttaggtatccgatatttgtaaatcatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttg
gttgtgtgaacatgaattattgtgcag
back to top
>EU047738.1-LFY667
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
cttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggctcgaca
gtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctaactctggaccgggtctgaatttttcattgat
tatgtggcagagtaagttcacaataaattttttgaaaaaagaaaaagaaaaagggggtttgtgaataagatcatatttta
atcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaat
tggataattggttagcttagtaaaggtagagattttcactcatgttttgttcgtttgcactccgctctttgttatatttt
gatgatctatcatttgcttttgttttccaaggtagaaaaacaatagaaaagtgcaaaccgataaaatcggagtgtgaaag
tcaccacccttaggtatccgatatttgtaaatcatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttg
gttgtgtgaacatgaattattgtgcag
back to top
>EU047737.1-LFY914
gtacggagtttacccaacctcccgtcttcataacctaaatgcatatgctgatttatactgtggtaaatattacattacaa
atttataaataaacccaatcctagacatgaatttataaaaaaacgcaacactatttaaaacatagaaacacacccaaaat
caacccaaaaatcaacaattgtatattttttaggtgtgtttataaatgggttttgagtgtttaatacatgggttttgggt
gtgtttataaagtgtttttcatattgggtttttttataatttcagcccctattttgagtgtattagtgaaactcccatag
taaatactaatagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattaca
atctagtggctcgacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctggaccgggtc
tgaatttttcattgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaaaaagggggtttgtgaata
agatcatattttaatcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaa
tatgacgtagaattggataattggttagcttagtgattttcacactcatgttttgttcgtttgcactccgttctttgtta
tattttgatgatctatcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtg
tgaaattcgcccacccttaggtatccgatatttataaataatgaatgatttatcttgtgaccatgacaagtgaattgttg
tattttggttgtgtggacatgaattattgtgcag
back to top
>EU047736.1-LFY667
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
cttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggctcgaca
gtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctaactctggaccgggtctgaatttttcattgat
tatgtggcagagtaagttcacaataaattttttgaaaaaagaaaaagaaaaagggggtttgtgaataagatcatatttta
atcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaat
tggataattggttagcttagtaaaggtagagattttcactcatgttttgttcgtttgcactccgctctttgttatatttt
gatgatctatcatttgcttttgttttccaaggtagaaaaacaatagaaaagtgcaaaccgataaaatcggagtgtgaaag
tcaccacccttaggtatccgatatttgtaaatcatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttg
gttgtgtgaacatgaattattgtgcag
back to top
>EU047735.1-LFY896
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaattacaa
atttataaataaatccaatcctagacatgaatttataaaaaaacgcaacactatttaaaacatagaaacacacccaaaat
caacaattgtatattttttaggtgtgtttataaatgggttttgagtgtttaatacatgggttttaggtgtgtttataaag
tgtttttcatgttgggtttttttataatttcagcccctattttgagtgtattagtgaaactcccatagtaaatactaata
gtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggctc
gacagtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctcactctgggccgggtctgaatttttcat
tgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaaaagggggtttgtgaataagatcatattttaat
cctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaattg
gataattggtaagcttagtgattttcacacatgttttgttcgtctgcactccgttctttgttatattttgatgatctatc
atctgcttttatttctcaaggtagaaaaacaatagaaaagtgcaaacggataaaatcggagtgtgaaagtcgccaccctt
aggtatccgatatttgtaaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttggttgtgtggac
atgaattattgtgcag
back to top
>EU047734.1-LFY667
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
cttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattacaatctagtggctcgaca
gtttcaattggaaacgcctgctgacaacatcaatataatgtttgagctaactctggaccgggtctgaatttttcattgat
tatgtggcagagtaagttcacaataaattttttgaaaaaagaaaaagaaaaagggggtttgtgaataagatcatatttta
atcctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaat
tggataattggttagcttagtaaaggtagagattttcactcatgttttgttcgtttgcactccgctctttgttatatttt
gatgatctatcatttgcttttgttttccaaggtagaaaaacaatagaaaagtgcaaaccgataaaatcggagtgtgaaag
tcaccacccttaggtatccgatatttgtaaatcatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttg
gttgtgtgaacatgaattattgtgcag
back to top