LFY, LFY (gene) Pyrus calleryana

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Pyrus calleryana
Synonym LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYGU991516.1-LFY.m1Pyrus calleryanamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPyrus calleryanagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database GU991516.1-LFY.m1 scaffold00514:5463..5866
GU991516.1

Sequence(s):
>GU991516.1-LFY.m1403
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggaggaggggcgacgtgggaggttgcgacggcaggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatttaaaaattgtagtgctggagggcgtcataataacgaggg
tatggacgacgaggacgacaacgacatggacgacatgactgggtatgggaacggtggaggagggggaatgctgggagaga
gacagagggagcacccgttcattgtgacggagcctggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttc
catctctacgagcaatgccgcgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaa
ggt
back to top