LFY, LFY (gene) Pyrus pashia

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Pyrus pashia
Synonym LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYGU991510.1-LFY.m1Pyrus pashiamRNA
LFYGU991509.1-LFY.m1Pyrus pashiamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPyrus pashiagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database GU991510.1-LFY.m1 scaffold00514:5463..5866
GU991510.1
mRNA parsed from NCBI nr database GU991509.1-LFY.m1 scaffold00514:5463..5866
GU991509.1

Sequence(s):
>GU991510.1-LFY.m1403
tgtcggaggagccagtgcaacaagagaaggagatggtagggagcggaggaggggcggcgtgggaggttgcaacggcaggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatttaaaaattgtagcgctggagggcgtcataataacgaggg
tgtggacgacgaggacgacaacgacatggacgacatgactgggtatgggaacggtggaggagggggaatgctgggagaga
gacagagggagcacccgttcattgtgacggagcctggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttc
catctctacgagcaatgccgcgatttcttgatccaggtccagaacattgcgaaggagcgcggtgaaaaatgtcccaccaa
ggt
back to top
>GU991509.1-LFY.m1403
tgtcggaggagccagtgcaacaagagaaggagatggtagggagcggaggaggggcggcgtgggaggttgcaacggcaggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatttaaaaattgtagcgctggagggcgtcataataacgaggg
tgtggacgacgaggacgacaacgacatggacgacatgactgggtatgggaacggtggaggagggggaatgctgggagaga
gacagagggagcacccgttcattgtgacggagcctggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttc
catctctacgagcaatgccgcgatttcttgatccaggtccagaacattgcgaaggagcgcggtgaaaaatgtcccaccaa
ggt
back to top