LFY, LFY (gene) Pyrus pyrifolia

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Pyrus pyrifolia
Synonym LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYGU991515.1-LFY.m1Pyrus pyrifoliamRNA
LFYGU991514.1-LFY.m1Pyrus pyrifoliamRNA
LFYGU991512.1-LFY.m1Pyrus pyrifoliamRNA
LFYGU991507.1-LFY.m1Pyrus pyrifoliamRNA
LFYGU991505.1-LFY.m1Pyrus pyrifoliamRNA
LFYGU991504.1-LFY.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database GU991515.1-LFY.m1 scaffold00514:5463..5866
GU991515.1
mRNA parsed from NCBI nr database GU991514.1-LFY.m1 scaffold00514:5463..5866
GU991514.1
mRNA parsed from NCBI nr database GU991512.1-LFY.m1 scaffold00514:5463..5866
GU991512.1
mRNA parsed from NCBI nr database GU991507.1-LFY.m1 scaffold00514:5463..5866
GU991507.1
mRNA parsed from NCBI nr database GU991505.1-LFY.m1 scaffold00514:5463..5866
GU991505.1
mRNA parsed from NCBI nr database GU991504.1-LFY.m1 N/A GU991504.1

Sequence(s):
>GU991515.1-LFY.m1403
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggaggaggggcgacgtgggaggttgcgactgcaggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatttaaaaattgtagtgctggagggcgtcataataacgaggg
tgtggacgacgaggacgacaacgacatggacgacatgactgggtatgggaacggcggaggagggggaatgctgggagaga
gacagagggagcacccgttcattgtgacggagcctggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttc
catctctacgagcaatgccgcgatttcttgatccaggtccagaacattgccaaggagcgtggtgaaaaatgtcccaccaa
ggt
back to top
>GU991514.1-LFY.m1403
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggaggaggggcgacgtgggaggttgcgacggcagga
gagaggcggaagaagcagcggaggatgaagaaggggcaatttaaaaattgtagtgctggagggcgtcataataacgaggg
tgtggacgacgaggacgacaacgacatggacgacatgactgggtatgggaacggcggaggagggggaatgctgggagaga
gacagagggagcacccgttcattgtgacggagcctggggaggtggcgcgtggcagaaagaacggcctcgattacctcttc
catctctacgagcaatgccgcgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaa
ggt
back to top
>GU991512.1-LFY.m1403
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggaggaggggcgacgtgggaggttgcgactgcaggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatttaaaaattgtagtgctggagggcgtcataataacgaggg
tatggacgacgaggacgacaacgacatggacgacatgactgggtatgggaacggtggaggagggggaatgctgggagaga
gacagagggagcacccgttcattgtgacggagcctggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttc
catctctacgagcaatgccgcgatttcttgatccaagtccagaacattgcgaaggagcgcggtgaaaaatgtcccaccaa
ggt
back to top
>GU991507.1-LFY.m1403
tgtcggaggagccagtgcaacaagagaaggagatggtagggagcggaggaggggcggcgtgggaggttgcaacggcaggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatttaaaaattgtagcgctggagggcgtcataataacgaggg
tgtggacgacgaggacgacaacgacatggacgacatgactgggtatgggaacggtggaggagggggaatgctgggagaga
gacagagggagcacccgttcattgtgacggagcctggggaggtggcgcgtggcaaaaagaacggcctcgattacctcctc
catctctacgagcaatgccgcgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaa
ggt
back to top
>GU991505.1-LFY.m1403
tgtcggaggagccagtgcaacaagagaaggagatggtagggagcggaggaggggcggcgtgggaggttgcaacggcaggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatttaaaaattgtagcgctggagggcgtcataataacgaggg
tgtggacgacgaggacgacaacgacatggacgacatgactgggtatgggaacggtggaggagggggaatgctgggagaga
gacagagggagcacccgttcattgtgacggagcctggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttc
catctctacgagcaatgccgcgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaa
ggt
back to top
>GU991504.1-LFY.m1403
tgtcggaggagccagtgcaacaagagaaggagatggtagggagcggaggaggggcggcgtgggaggttgcaacggcaggg
gagaggcggaggaagcagcggaggatgaagaaggggcaatttaaaaattgtagcgctggagggcgtcataataacgaggg
tgtggacgacgaggacgacaacgacatggacgacatgactgggtatgggaacggtggaggagggggaatgctgggagaga
gacagagggagcacccgttcattgtgacggagcctggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttc
catctctacgagcaatgccgcgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccat
ggt
back to top