LFY, LFY (gene) Rosa canina

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Rosa canina
Synonym LEAFY protein
leafy
Description transcription factor
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYFR725966.1-LFYRosa caninagene
LFYFR725965.1-LFYRosa caninagene
LFYFR725964.1-LFYRosa caninagene
LFYFR725963.1-LFYRosa caninagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYFR725966.1-LFY.m1Rosa caninamRNA
LFYFR725965.1-LFY.m1Rosa caninamRNA
LFYFR725964.1-LFY.m1Rosa caninamRNA
LFYFR725963.1-LFY.m1Rosa caninamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYRosa caninagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database FR725966.1-LFY N/A FR725966.1
gene parsed from NCBI nr database FR725965.1-LFY N/A FR725965.1
gene parsed from NCBI nr database FR725964.1-LFY N/A FR725964.1
gene parsed from NCBI nr database FR725963.1-LFY N/A FR725963.1
mRNA parsed from NCBI nr database FR725966.1-LFY.m1 N/A FR725966.1
mRNA parsed from NCBI nr database FR725965.1-LFY.m1 N/A FR725965.1
mRNA parsed from NCBI nr database FR725964.1-LFY.m1 N/A FR725964.1
mRNA parsed from NCBI nr database FR725963.1-LFY.m1 N/A FR725963.1

Sequence(s):
>FR725966.1-LFY1976
gcggttccgccgagccgggttcagctcgaggcggcggcggcggcagtatcgccacaacaagcggcggctgcggccgcagc
cgcgggttactcggtgcgggggccgagggaggttgtggggctggaggacatgttccgggcgtacggagtgaggtactaca
cagcggcgaggatagcggacctcgggttcactgtgagcacgcttttggacatgaaagatgaggagcttgacgacatgatg
aacagcgtatctcagtttttccgggtggagctactcgtcggtgagacgtacggcattaaggccgccatcagagccgagag
gagactccttgaggaagaggactcgcgggggcgccacgctctctccggcgacgccaacgctatggatgctctctctcaag
aaggttaatttcctagccatacgtgcataaatctgacagttttacctccatgaaaggctagacctaggagttgcacacaa
gattttaccttattaaccgtatctaataataattttttttttttttgagaaaacataaactgtcttataatcggatagca
tgtcagagatctgtaacaataaatattgttaggttttggacatgtaaataggtcgagaatatattttctttgtgcactca
actttttgatgagcatctcgatttaaatcttgattattcaaaagtaattaactgaaatatcgggaaatgattttgaaaaa
tagtgaaagacatttgatcagttgaataatacatcttaaatgtgtctatgtttaaatcatttatttactttgaaacaaag
gaagtgttgacatatatgtccataattgtgatatttggtgcatgggatggttggacagggctgtcggaggagccggtgcg
acaagagaaggagatggtggggagcggccggagagccgcgtgggaagtggttacggcggcggagaagcggaagaagctgc
ggaggattaggagaggagtaggaggagggcataggagtagtaacgagggggttgatgatgatgaggaggaggaagagact
gaggacggcattaatggtggaggaggggagcacccgagtagggcattagcaatgaggggtggtgggagagagagacagag
ggagcacccgttcatcgtaactgaggctggggaggtggcacgtggcaaaaagaacggactggattacctctttcatctgt
acgagcagtgccatgagtttttgacccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtacgt
agtaattctacagttaacaccacccatgcattctccttctgcttctctactgtggtaaaacagtagttaatcattaaaat
caatagaaattagaggtaaacaactattcactcaaaaggggacttggtcatgatggtcataattgtgattttgacaaaat
taccggtgagttatttcactcaatagtagctgcagcagacccatttcagttcgtaccaattaaccagctgttcctccaga
agcttgatatttggctatttgctacttacaccatccataaaagatcacattctagtctggtttttattcaatgcgatttg
aacattattcggaaagaaaaaatgaatatatacagatgagttcattcaagtgtgctatcaatttcgatctacaggtgaca
aaccaggtgtttaggtatgcgaaaaaggagggagcaaactacatcaataagccaaaaatgcgacactatgttcactgcta
tgcgctgcattgcctggacgaggagggttcgaatgcgctgaggagagagtgcaaactgcgaggtgagaaccttgggacgt
ggaggcaggcgtgttacaggcctgttgtggaaatagctgcaggccaaggctgggacattgatgccattttcagtgcacat
cctcagctatctgtttggtatgttcctaccaaacttcgtcagctttgtcacgccga
back to top
>FR725965.1-LFY1925
gcggttccgccgagccgggttcacctcgaggcggcggcagtagcgccacaacaagccgccgcagccgcgggttactcggt
gcgggggccgagggaggttgtggggctggaggacatgttccgggcgtacggagtgaggtactacacagcggcgaggatag
cggacctagggttcactgtgagcacgcttttggacatgaaagatgaggagcttgacgacatgatgaacagtgtatctcag
tttttccgggtggagctactcgtcggtgagaggtacggcattaaggccgccatcagagccgagaggagacgccttgagga
agaggactcgcggaggcgccacgctctctccggcgacaccaacgctatggatgctctctctcaagaaggttaatttccta
gccatacgtgcataaatctgatagttttacctccatggaaggctagacctaggagttgcacacaagaattttaccttatt
aaccgtatctaatagttttttttttttttttttgagaaaacattaaccgtctttataatcggatagcatgtcagagatct
gtaacaataaatattgttaggttttggacacgtaaataggtcgagaattctctttgtgcactcaactttttgatgagcat
ctggatttaaatcttgattattcaaaagtaattaactgaaatatcgggaaatgattatttttttcaaagtgaaagacatt
tgatcagttgaataatacatctttaatgtgtctatgtttaaatcatttattcacatttatttactttgaaacaatggaag
tattgacatatatgtccataattgtgatatttggtgcatgggatggttggacagggctgtcggaggagccggtgcaacaa
gagaaggagatggtggggagcggcggaggagccgcgtgggaagtggttacggcggcggagaagcggaagaagcttcggag
gattaggagaggagtaggagggcataggagtagtaacgagggggttgatgatgatgaggaggaggaagaaaatgaggacg
gcattaatggtggaggaggggagcacccgagtagggcattagcaatgaggggtggtgggagggagagacagagggagcac
ccgttcatcgtaactgaggctggggaggtggcacgtggcaaaaagaacggactggattacctctttcatctgtatgagca
gtgccatgagtttttgacccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtacgtagtactt
ctacagttaacaccacccatgcattctccttgtgcttctctactgtagtaaaacagtagttaatcattataaactattca
ctcaaaagggtacttggtcatggtggtcaaaattgtgattttgacaaaattaccggtgagttatttcactcaatagcagc
tgcagcagacccatttcagttcgtaccaaaagcttgatatttggctatttgctactgacaccatccataaaagatcacat
tctagtctggtttttattcaatgcgatttgaacattattcggaaagaaaatatgatatatacagatgagttaattcaagt
gtgctatcaatttcgatctacaggtgacaaaccaggtgtttaggtatgcgaaaaaggagggagcaaactacatcaataag
cccaaaatgcgacactatgttcactgctatgcgctgcattgcctggacgaggagggttcgaatgcgctgaggagagagtg
caaactgcgaggcgagaacattggggcgtggaggcaggcgtgttacaggcctgttgtggaaatagctgcaggccaaggct
gggacattgatgccatttttagtgcacatcctcagctatctgtttggtatgttcctaccaaacttcgtcagctttgtcac
gccga
back to top
>FR725964.1-LFY1964
gcggttccgccaagccgggttcagctcgaggcggcggcagtatcgccacaacaagcggctgctgcggccgcagccgcggg
ttactcggtgcgggggccgagggaggttgtggggctggaggacatgttccgggcgtacggagtgaggtactacacagcgg
cgaggatagcggacctcgggttcactgtgagcacgcttttggacatgaaagatgaggagcttgacgacatgatgaacagc
gtatctcagtttttccgggtggagctactcgtcggtgagaggtacggcattaaggccgccatcagggccgagaggagacg
ccttgaggaagaggactcgcggaggcgccacgctctctccggcgacgccaacgctatggatgctctctctcaagaaggtt
aatttcctagccatacgtgcataaatctgacagttttacctccatgaaaggctagacctaggagttgcacacaagaattt
tactttattaaccgtatctaataataatttttttttttttaagaaaacattaaccgtcttataatcggatagcatgtcag
agatctgtaacaataaatattgttaggttttggacatgtaaataggtcgagaattctctttgtgcactcaactttttgat
gagcatctcgatttaaatcttgattattcaaaagtaattaactgaaatatcgggaaatgattttgaaaaatagtgaaaga
catttgatcagttgaataatacatcttaaatgtgtacgtttaaatcatttatttactttgaaacaaaggaagtgttgaca
tatatgtccataattgtgatatttggtgcatgggatggttgtacagggctgtcggaggagccggtgcaacaagagaagga
gatggtggggagcggcggaggagccgcgtgggaagtggttacggcggcggagaagcggaagaagctgcggaggattagga
gaggagtaggaggagggcataggagtagtaacgagggggttgatgatgatgaggaggaggaagagaatgaggacggcatt
aatggtggaggaggggagcacccgagtagggcattagcaatgaggggtggtgggagagagagacagagggagcacccgtt
catcgtaactgaggctggggaggtggcacgtggcaaaaagaacggactggattacctctttcatctgtacgagcagtgcc
atgagtttttgacccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtacgtagtaattctaca
gttaacaccacccatgcattctccttctgcttctctactgtggtaaaacagtagttaatcattaaaatcaatagaaatta
gaggtaaacaactattcactcaaaaggggacgtggtcatgatggtcataattgtgattttgacaaaattaccggtgagtt
atttcactcaatagtagctgcagcagacccatttcagttcgtaccaattaaccagctgttcctccagaagcttgatattt
ggctatttgctactgacaccatccataaaagatcacattctagtctggtttttattcaatgcgatttgaacattattcgg
aaagaaaaaatgaatatatacagatgagttcattcaagtgtgctatcaatttcgatctacaggtgacaaaccaggtgttt
aggtatgcgaaaaaggagggagcaaactacatcaataagccaaaaatgcgacactatgttcactgctatgcgctgcattg
cctggacgaggagggttcgaatgcgctgaggagagagtgcaaactgcgaggtgagaacattgggacgtggaggcaggcgt
gttacaggcctgttgtggaaatagctgcaggccaaggctgggacattgatgccattttcagtgcacatcctcagctatct
gtttggtatgttcctaccaaacttcgtcagctttgtcacgccga
back to top
>FR725963.1-LFY1995
gctgttccgccgagccgggttcacctcgaggcggcggcagtagcgccacaacaagctgcggccgctgccgcagccgcggg
ttactctgtgcgggggccgagggaggttgtgggcctggaggacatgttccgggcgtacggagtgaggtactacacagcgg
cgaggatagcggacctagggttcactgtgagcacgcttttggacatgaaagatgaggagcttgacgacatgatgaacagc
gtatctcagtttttccgggtggagctactcgtcggtgagaggtacggcattaaggccgccatcagagccgagaggagacg
ccttgaggaagaggactcgcggaggcgccacgctctctccggcgacaccaacgctatggatgctctctctcaagaaggtt
aatttcctagccatacgtgcataaatctgatagttttacctccatggaaggctagacctaggagttgcacacaagaattt
taccttattaaccgtatctaataattttttttttttttttttgagaaaacattaaccgtctttataatcggatagcatgt
cagagatctgtaacaataaatattgttaggttttggacacgtaaataggtcgagaattctctttgtgcactcaacttttt
gatgagcatctggatttaaatcttgattattcaaaagtaattaactgaaatatcgggaaatgattatttttttcaaagtg
aaagacatttgatcagttgaataatacatctttaatgtgtctatgtttaaatcatttattcacatttatttactttgaaa
caatggaagtattgacatatatgtccttaattgtgatatttggtgcatggaatggttggacagggctgtcggaggagccg
gtgcaacaagagaaggagatggtggggagcggcggaggagccgcgtgggaagtggttacggcggcggagaagcggaagaa
gcttcggaggattaggagaggagtaggagggcataggagtagtaacgagggggttgatgatgatgaggaggaggaagaga
atgaggacggcattaatggtggaggcggggagcacccgagtagggcattagcaatgaggggtggtgggagagagagacag
agggagcacccgttcatcgtaactgaggctggggaggtggcacgtggcaaaaagaacggactggattacctctttcatct
gtatgagcagtgccatgagtttttgacccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtam
gtagtacttctacagttaacaccacccatgcattctccttgtgcttctctactgtagtaaaacagtacttctacagttaa
caccacccatgcattctccttgtgcttctctactgtggtaaaacagtagttaatcattataaactattcactcaaaaggg
aacttggtcatggtggtcacaattgtgattttgacaaaattactggtgagttatttcactcaatagcagctgcagcagac
ccatttcagttcgtaccaaaagcttgatatttggctatttgctactgacaccatccataaaagatcacattctagtctgg
tttttattcaatgcgatttgaacattattcggaaagaaaatatgatatatacagatgagttaattcaagtgtgctatcaa
tttcgatctacaggtgacaaaccaggtgtttaggtatgcgaaaaaggagggagcaaactacatcaataagcccaaaatgc
gacactatgttcactgctatgcgctgcattgcctggacgaggagggttcgaatgcgctgaggagagagtgcaaactgcga
ggcgagaacattggggcgtggaggcaagcgtgttacaggcctgttgtggaaatagctgcaggccaaggctgggacattga
tgccatttttagtgcacatcctcagctatctgtttggtatgttcctaccaaacttcgtcagctttgtcacgccga
back to top
>FR725966.1-LFY.m11121
gcggttccgccgagccgggttcagctcgaggcggcggcggcggcagtatcgccacaacaagcggcggctgcggccgcagc
cgcgggttactcggtgcgggggccgagggaggttgtggggctggaggacatgttccgggcgtacggagtgaggtactaca
cagcggcgaggatagcggacctcgggttcactgtgagcacgcttttggacatgaaagatgaggagcttgacgacatgatg
aacagcgtatctcagtttttccgggtggagctactcgtcggtgagacgtacggcattaaggccgccatcagagccgagag
gagactccttgaggaagaggactcgcgggggcgccacgctctctccggcgacgccaacgctatggatgctctctctcaag
aagggctgtcggaggagccggtgcgacaagagaaggagatggtggggagcggccggagagccgcgtgggaagtggttacg
gcggcggagaagcggaagaagctgcggaggattaggagaggagtaggaggagggcataggagtagtaacgagggggttga
tgatgatgaggaggaggaagagactgaggacggcattaatggtggaggaggggagcacccgagtagggcattagcaatga
ggggtggtgggagagagagacagagggagcacccgttcatcgtaactgaggctggggaggtggcacgtggcaaaaagaac
ggactggattacctctttcatctgtacgagcagtgccatgagtttttgacccaggtccagaacattgccaagcagcgcgg
tgaaaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgcgaaaaaggagggagcaaactacatcaataagccaa
aaatgcgacactatgttcactgctatgcgctgcattgcctggacgaggagggttcgaatgcgctgaggagagagtgcaaa
ctgcgaggtgagaaccttgggacgtggaggcaggcgtgttacaggcctgttgtggaaatagctgcaggccaaggctggga
cattgatgccattttcagtgcacatcctcagctatctgtttggtatgttcctaccaaacttcgtcagctttgtcacgccg
a
back to top
>FR725965.1-LFY.m11103
gcggttccgccgagccgggttcacctcgaggcggcggcagtagcgccacaacaagccgccgcagccgcgggttactcggt
gcgggggccgagggaggttgtggggctggaggacatgttccgggcgtacggagtgaggtactacacagcggcgaggatag
cggacctagggttcactgtgagcacgcttttggacatgaaagatgaggagcttgacgacatgatgaacagtgtatctcag
tttttccgggtggagctactcgtcggtgagaggtacggcattaaggccgccatcagagccgagaggagacgccttgagga
agaggactcgcggaggcgccacgctctctccggcgacaccaacgctatggatgctctctctcaagaagggctgtcggagg
agccggtgcaacaagagaaggagatggtggggagcggcggaggagccgcgtgggaagtggttacggcggcggagaagcgg
aagaagcttcggaggattaggagaggagtaggagggcataggagtagtaacgagggggttgatgatgatgaggaggagga
agaaaatgaggacggcattaatggtggaggaggggagcacccgagtagggcattagcaatgaggggtggtgggagggaga
gacagagggagcacccgttcatcgtaactgaggctggggaggtggcacgtggcaaaaagaacggactggattacctcttt
catctgtatgagcagtgccatgagtttttgacccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaa
ggtgacaaaccaggtgtttaggtatgcgaaaaaggagggagcaaactacatcaataagcccaaaatgcgacactatgttc
actgctatgcgctgcattgcctggacgaggagggttcgaatgcgctgaggagagagtgcaaactgcgaggcgagaacatt
ggggcgtggaggcaggcgtgttacaggcctgttgtggaaatagctgcaggccaaggctgggacattgatgccatttttag
tgcacatcctcagctatctgtttggtatgttcctaccaaacttcgtcagctttgtcacgccga
back to top
>FR725964.1-LFY.m11115
gcggttccgccaagccgggttcagctcgaggcggcggcagtatcgccacaacaagcggctgctgcggccgcagccgcggg
ttactcggtgcgggggccgagggaggttgtggggctggaggacatgttccgggcgtacggagtgaggtactacacagcgg
cgaggatagcggacctcgggttcactgtgagcacgcttttggacatgaaagatgaggagcttgacgacatgatgaacagc
gtatctcagtttttccgggtggagctactcgtcggtgagaggtacggcattaaggccgccatcagggccgagaggagacg
ccttgaggaagaggactcgcggaggcgccacgctctctccggcgacgccaacgctatggatgctctctctcaagaagggc
tgtcggaggagccggtgcaacaagagaaggagatggtggggagcggcggaggagccgcgtgggaagtggttacggcggcg
gagaagcggaagaagctgcggaggattaggagaggagtaggaggagggcataggagtagtaacgagggggttgatgatga
tgaggaggaggaagagaatgaggacggcattaatggtggaggaggggagcacccgagtagggcattagcaatgaggggtg
gtgggagagagagacagagggagcacccgttcatcgtaactgaggctggggaggtggcacgtggcaaaaagaacggactg
gattacctctttcatctgtacgagcagtgccatgagtttttgacccaggtccagaacattgccaagcagcgcggtgaaaa
atgtcccaccaaggtgacaaaccaggtgtttaggtatgcgaaaaaggagggagcaaactacatcaataagccaaaaatgc
gacactatgttcactgctatgcgctgcattgcctggacgaggagggttcgaatgcgctgaggagagagtgcaaactgcga
ggtgagaacattgggacgtggaggcaggcgtgttacaggcctgttgtggaaatagctgcaggccaaggctgggacattga
tgccattttcagtgcacatcctcagctatctgtttggtatgttcctaccaaacttcgtcagctttgtcacgccga
back to top
>FR725963.1-LFY.m11112
gctgttccgccgagccgggttcacctcgaggcggcggcagtagcgccacaacaagctgcggccgctgccgcagccgcggg
ttactctgtgcgggggccgagggaggttgtgggcctggaggacatgttccgggcgtacggagtgaggtactacacagcgg
cgaggatagcggacctagggttcactgtgagcacgcttttggacatgaaagatgaggagcttgacgacatgatgaacagc
gtatctcagtttttccgggtggagctactcgtcggtgagaggtacggcattaaggccgccatcagagccgagaggagacg
ccttgaggaagaggactcgcggaggcgccacgctctctccggcgacaccaacgctatggatgctctctctcaagaagggc
tgtcggaggagccggtgcaacaagagaaggagatggtggggagcggcggaggagccgcgtgggaagtggttacggcggcg
gagaagcggaagaagcttcggaggattaggagaggagtaggagggcataggagtagtaacgagggggttgatgatgatga
ggaggaggaagagaatgaggacggcattaatggtggaggcggggagcacccgagtagggcattagcaatgaggggtggtg
ggagagagagacagagggagcacccgttcatcgtaactgaggctggggaggtggcacgtggcaaaaagaacggactggat
tacctctttcatctgtatgagcagtgccatgagtttttgacccaggtccagaacattgccaagcagcgcggtgaaaaatg
tcccaccaaggtgacaaaccaggtgtttaggtatgcgaaaaaggagggagcaaactacatcaataagcccaaaatgcgac
actatgttcactgctatgcgctgcattgcctggacgaggagggttcgaatgcgctgaggagagagtgcaaactgcgaggc
gagaacattggggcgtggaggcaagcgtgttacaggcctgttgtggaaatagctgcaggccaaggctgggacattgatgc
catttttagtgcacatcctcagctatctgtttggtatgttcctaccaaacttcgtcagctttgtcacgccga
back to top