LFY, LFY (gene) Rosa lucieae

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Rosa lucieae
Synonym putative LEAFY protein
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYRosa lucieaegene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYFM999801.1-LFY.m1Rosa lucieaemRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database FM999801.1-LFY.m1 N/A FM999801.1

Sequence(s):
>FM999801.1-LFY.m1401
gtggcacgagggaaaaagaatggactggattacctctttcatctgtatgagcagtgccatgagtttttgacccaggtcca
gaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgcgaaaaaggagggag
caaactacatcaataagcccaaaatgcgacactatgttcactgctatgcgctgcattgcctggacgaggagggttcgaat
gcgctgaggagagagtgcaaactgcgaggcgagaacattggggcgtggaggcaggcgtgttacaggcctgttgtggaaat
agctgcaggccaaggctgggacattgatgccattttcagtgcacatcctcagctatctgttgggtacgtccccaaatcac
t
back to top