LFY, LFY (gene) Rubus buergeri

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Rubus buergeri
Synonym NA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYDQ073628.1-LFYRubus buergerigene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYRubus buergerigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ073628.1-LFY N/A DQ073628.1

Sequence(s):
>DQ073628.1-LFY570
aaaccgggcatctttttttgttgtttttattttggctaagaagcctgtaagttgaacgccagccatatgtagcttgaact
gtgatggccacaatgcttagctattgccggtacccaagacgcctttggttgaatgttcacacctgatccaccgtctgcac
ttcctacattcactcccggaaattgaaacaggaaaacgggaattgtaacctcccggtctgctgtagtcagcctcagggtg
tgcctgactggcgagtctgccgtctccacggcttcccggctgctcctcaagccttcgagtgccgatcttcgattgggccg
tctcgcgaagatcttcgatccgcatctactctctcttagaggatgaaccacgccttcgctatcgaaagaatatagcgatc
gaagagagctatcgctcagccgcttcgcgtattacttacgaaagccgtattgcccgaagggggcatgctgcaagagcgta
ggtgagtggtaagcgtaggaggcgtgcccgaagggcagcggcagcagtgtggttccaggtgccgtcgctagattgagatc
cgcagggtgg
back to top