LFY, LFY (gene) Rubus parvifolius

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Rubus parvifolius
Synonym NA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYDQ073631.1-LFYRubus parvifoliusgene
LFYDQ073630.1-LFYRubus parvifoliusgene
LFYDQ073629.1-LFYRubus parvifoliusgene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYRubus parvifoliusgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ073631.1-LFY N/A DQ073631.1
gene parsed from NCBI nr database DQ073630.1-LFY N/A DQ073630.1
gene parsed from NCBI nr database DQ073629.1-LFY N/A DQ073629.1

Sequence(s):
>DQ073631.1-LFY572
aaaccgggcatctttttttgttgtttttattttggctaagaagcctgtaggttgtacgccagccatatgtagcttgaact
gtgatggccacaatgcttagctattgccggtacccaagacgcctttggttgaatgttcacacctgatccaccgtctgcac
ttcctacattcactcccggaaattgaaacaggaaaatgggaattgtaacctcccggtctgctgtatcagcctcaggggtg
tgcctgactggcgagtccgccgtctccacggcttcccggctgctcctcaagccttcgagtgccgatcttcgcttgggccg
tctcgcgaagatcttcgatccgcatctactctctcttagaggatgaaccacgccttcgctatcgaaagaatatagcgatc
gaagagagctatcgctcagccgcttcgcgtattacttatgaaagccgtattgcccgaagggggcatgctgcaagagcgta
ggtgagtggtaagcgtaggaggcgtgcccggaagggcagcgacagcagtgtggttccagggtgccgtcgctagattgaga
tccgcagggtgg
back to top
>DQ073630.1-LFY570
aaaccgggcatctttttttgttgtttttattttggctaagaagcctgtaggttgtacgccagccatatgtagcttgaact
gtgatggccacaatgcttagctattgccggtacccaagacgcctttggttgaatgttcacacctgatccaccgtctgcac
ttcctacattcactcccggaaattgaaacaggaaaatgggaattgtaacctcccggtctgctgtagtcagcctcagggtg
tgcctgactggcgagtccgccgtctccacggcttcccggctgctcctcaagccttcgagtgccgatcttcgcttgggccg
tctcgcgaagatcttcgatccgcatctactctctcttagaggatgaaccacgccttcgctatcgaaagaatatagcgatc
gaagagagctatcgctcagccgcttcgcgtattacttatgaaagccgtattgcccgaagggggcatgctgcaagagcgta
ggtgagtggtaagcgtaggaggcgtgcccgaagggcagcggcagcagtgtggttccaggtgccatcgctagattgagatc
cgcagggtgg
back to top
>DQ073629.1-LFY570
aaaccgggcatctttttttgttgtttttattttggctaagaagcctgtaggttgtacgccagccatatgtagcttgaact
gtgatggccacaatgcttagctattgccggtacccaagacgcctttggttgaatgttcacacctgatccaccgtctgcac
ttcctacattcactcccggaaattgaaacaggaaaatgggaattgtaacctcccggtctgctgtagtcagcctcagggtg
tgcctgactggcgagtccgccgtctccacggcttcccggctgctcctcaagccttcgagtgccgatcttcgcttgggccg
tctcgcgaggatcttcgatccgcatctactctctcttagaggatgaaccacgccttcgctatcgaaagaatatagcgatc
gaagagagctatcgctcagccgcttcgcgtattacttatgaaagccgtattgcccgaagggggcatgctgcaagagcgta
ggtgagtggtaagcgtaggaggcgtgcccgaagggcagcggcagcagtgtggttccaggtgccgtcgctagattgagatc
cgcagggtgg
back to top