LFY, LFY (gene) Rubus plicatus

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Rubus plicatus
Synonym NA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYDQ073614.1-LFYRubus plicatusgene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYRubus plicatusgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ073614.1-LFY N/A DQ073614.1

Sequence(s):
>DQ073614.1-LFY570
aaaccgggcatctttttttgttgtttttattttggctaagaagcctgtaagttgaacgccagccatatgtagcttgaact
gtgatggccacaatgcttagctattgccggtacccaagacgcctttggttgaatgttcacacctgatccaccgtctgcac
ttcctacattcactcccggaaattgaaacaggaaaacgggaattgtaaccccccggtctgctgtagtcagcctcagggtg
tgcctgactggcgagtctgccgtctccacggcttcccggctgctcctcaagccgtggagtgccgatcttcgcttgggccg
tctcgcgaagatcttcgatccgcatctactctctcttagaggatgaaccacgccttcgctatcgaaagaatatagcgatc
gaagagagctatcgctcagccgcttcgcgtattacttacgaaagccgtattccccgaagggggcatgctgcaagagcgta
ggtgagtggtaagcgtaggaggcgtgcccgaagggcagcggcagcagtgtggttccaggtgccgtcgctagattgagatc
cgcagggtgg
back to top