F3H, HM854009.1-F3H.m1 (mRNA) Fragaria virginiana

Transcript Overview
Unique NameHM854009.1-F3H.m1
OrganismFragaria virginiana ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
F3HF3HFragaria virginianagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM854009.1-F3H.m1-cds1HM854009.1-F3H.m1-cds1Fragaria virginianaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
F3HHM854009.1-F3H.p1Fragaria virginianapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HM854009 region HM854009:1..1539+ NCBI Rosaceae gene and mRNA sequences
LG5 chromosome LG5:7611689..7614828+ Fragaria vesca Whole Genome v1.0 (build 8) Assembly & Annotation
Property NameValue
Productflavonoid 3'-hydroxylase
The following sequences are available for this feature:

mRNA sequence

>HM854009.1-F3H.m1 ID=HM854009.1-F3H.m1|Name=F3H|organism=Fragaria virginiana|type=mRNA|length=1539bp
back to top

protein sequence of F3H

>HM854009.1-F3H.p1 ID=HM854009.1-F3H.p1|Name=F3H|organism=Fragaria virginiana|type=polypeptide|length=512bp
back to top

mRNA from alignment at HM854009:1..1539+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM854009.1-F3H.m1 ID=HM854009.1-F3H.m1|Name=F3H|organism=Fragaria virginiana|type=mRNA|length=1539bp|location=Sequence derived from alignment at HM854009:1..1539+ (Fragaria virginiana)
atgtttctcatagcagcgatcacccttctcgtcgccgtggttctattccg gcttcttttctccggcaaatcccaacgtcgctcgcttcctctccctcctg gccccaaaccatggcctgtcgtcgggaacttgcctcacttgggccctttt ccgcaccactctctcgcggagttggcgcagaaacacgggcccctcatgca cctccgcctcggttatgttgacgtagtggtggcggcatcagcatccgtag cgtctcagttcttgaagactcacgacgctaacttctccagccggccaccc aactcaggcgccaagtacatggcctacaactaccaggacctcgtgttcag gccctacagtccacggtggcgccagttccggaagatcagctcagtccatc ttttctccggcaaggccttggatgaccttaaacacgtccggcaggaggag gtagctgtgctagcgcatgccttagcaaatgcagggtcaaaggtagtgaa cctggcgcaactactcaacttgtgcacggtcaacgccctagggcgagtga tggtagggcggagggttttcggcgacggcagcggcagcgacgatccgaag gcggacgagttcaagtcaatggtggtggagatgatggtgttggcaggagt gcccaacataggtgacttcattccctgccttgagtggcttgacttgcaag gtgtggcgtccaagatgaagaagctccacaagagattcgacgacttcttg atggccattgtcgaggatcacaagaagagcaccggcacggcgacgcacgt cgacatgttgaccactctgctctccctccaggaagacgccgacggcgaag gtgccaagctcaccgacaccgagatcaaggctttgcttttgaacatgttc acagctggcactgatacgtcatcgagcactgtggaatgggcattggccga acttattaagcaccctcatatgttagcgcgactccgaaaagagttggacg atgttgttggacatgaccgactcgtgacagaaccggacctacccaagctc acctacatccaggccgttatcaaggagacgttccggcttcacccgtccac tcctctctcattgcctcgtatggcggccgagagttgtgaaatcaacgggt accacatcccgaagggttccacattgttagtcaatatatgggccatatcg cgtgacccggctgaatgggccgaaccgttggagttcaggcccgaaaggtt cttaccgggcagcgaaaagcctaatgttgatattagaggaaatgattttg aagtcatacccttcggtgctgggagaagaatatgtgctgggatgagcttg ggcctccgtatggtcagtttgatgactgcaacattggtccatgcgtttga ttggaccttggcggatgggacacctgagaagttaaacatggatgaagcat ttgggctcactctacaacgagctgcaccgttaatgatgcacccgcgcacc cggctagccccacatgcttataaaacttcatcatcttaa
back to top

Coding sequence (CDS) from alignment at HM854009:1..1539+

>HM854009.1-F3H.m1 ID=HM854009.1-F3H.m1|Name=F3H|organism=Fragaria virginiana|type=CDS|length=1539bp|location=Sequence derived from alignment at HM854009:1..1539+ (Fragaria virginiana)
back to top