PL, KJ547669.1-PL.m1 (mRNA) Pyrus x bretschneideri

Transcript Overview
Unique NameKJ547669.1-PL.m1
OrganismPyrus x bretschneideri ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
PLPLPyrus x bretschneiderigene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KJ547669.1-PL.m1-cds1KJ547669.1-PL.m1-cds1Pyrus x bretschneideriCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
PLKJ547669.1-PL.p1Pyrus x bretschneideripolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KJ547669 region KJ547669:1..1245+ NCBI Rosaceae gene and mRNA sequences
scaffold01715 supercontig scaffold01715:4350..6245- Pyrus communis Genome v1.0 Draft Assembly & Annotation
Property NameValue
Productpectate lyase
Genbank noteforms right handed beta helix structure; involved in maceration and soft rotting of plant tissue
The following sequences are available for this feature:

mRNA sequence

>KJ547669.1-PL.m1 ID=KJ547669.1-PL.m1|Name=PL|organism=Pyrus x bretschneideri|type=mRNA|length=1245bp
back to top

protein sequence of PL

>KJ547669.1-PL.p1 ID=KJ547669.1-PL.p1|Name=PL|organism=Pyrus x bretschneideri|type=polypeptide|length=414bp
back to top

mRNA from alignment at KJ547669:1..1245+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KJ547669.1-PL.m1 ID=KJ547669.1-PL.m1|Name=PL|organism=Pyrus x bretschneideri|type=mRNA|length=1245bp|location=Sequence derived from alignment at KJ547669:1..1245+ (Pyrus x bretschneideri)
atgccaaaaatggcaaggccctcctcaggcccctcacttctctctctcct cctcctctctctcctcttcccaaccctcatttcctccaggccacttcatc tccaagaccctgaattggtagtacaagaggtacaaaggaatattagcgac tcagtgtctaggaggaacttgggctacttgtcatgcgggacgggcaaccc tatcgacgactgctggcggtgcgacccgaactgggagaagaacaggcaga gcctagcagattgtgcgatagggttcggaaagaacgccataggtggaaga gacgggaagatttacgtggtcacagattccggcgacgacgaccctgtgaa ccccaagccaggaaccctacgacacgccgtcatccaagaggagccattat ggatcattttccagcgcgacatgaccatccagctgaaggaggagctgatc atgaactccttcaagacaatcgacggccggggagcgtccgtacacattgc cggtgggccatgcatcaccatccagttcgtgaccaacattattatccacg gactgcacatacacgattgcaagcagggtgggaacgctatggtgaggagc tcccccagtcacttcgggtggaggaccgtatcggacggcgacggcgtgtc gatcttcggtgggagccacgtgtgggtggaccattgctcgttgtccaact gcaaagatgggttggttgatgcgatttatgggtccactgcgataacgatt tcgaacaattacatgacgcaccatgataaggtgatgcttttggggcatag cgattcgtataccaaggacaagaacatgcaaatcaccattgcgttcaatc actttggagaaggcttggtccaaagaatgccaagatgtaggcatggatat ttccatgtggtgaacaatgactacacccattgggagatgtatgccattgg tgggagtgcagaccctacaatcaatagccaagggaacagatttgctgcac cagatatcagatccagcaaagaggtgaccaaacatgaggatgcacccgaa agtgaatggaagaattggaactggaggtcggaaggagacttgctgctcaa cggtgcgttttttacggcatcaggtgccggagcttcctcaagctacgcca gggcttcgagcttgggtgcgaagccatcttctctagtgggtgcgattacc acggcttccggcgcactcagttgccggaagggctctcgttgctga
back to top

Coding sequence (CDS) from alignment at KJ547669:1..1245+

>KJ547669.1-PL.m1 ID=KJ547669.1-PL.m1|Name=PL|organism=Pyrus x bretschneideri|type=CDS|length=1245bp|location=Sequence derived from alignment at KJ547669:1..1245+ (Pyrus x bretschneideri)
back to top