FAD2, KC702671.1-FAD2.m1 (mRNA) Malus baccata

Transcript Overview
Unique NameKC702671.1-FAD2.m1
OrganismMalus baccata ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
FAD2FAD2Malus baccatagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KC702671.1-FAD2.m1-cds1KC702671.1-FAD2.m1-cds1Malus baccataCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
FAD2KC702671.1-FAD2.p1Malus baccatapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KC702671 region KC702671:1..1149+ NCBI Rosaceae gene and mRNA sequences
Chr12 chromosome Chr12:6578245..6579393- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr9 chromosome chr9:10738063..10739211+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr9 chromosome chr9:11322769..11323917+ Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
Productendoplasmic reticulum 18:1 desaturase
Genbank noteMbFAD2
The following sequences are available for this feature:

mRNA sequence

>KC702671.1-FAD2.m1 ID=KC702671.1-FAD2.m1|Name=FAD2|organism=Malus baccata|type=mRNA|length=1149bp
back to top

protein sequence of FAD2

>KC702671.1-FAD2.p1 ID=KC702671.1-FAD2.p1|Name=FAD2|organism=Malus baccata|type=polypeptide|length=382bp
back to top

mRNA from alignment at KC702671:1..1149+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KC702671.1-FAD2.m1 ID=KC702671.1-FAD2.m1|Name=FAD2|organism=Malus baccata|type=mRNA|length=1149bp|location=Sequence derived from alignment at KC702671:1..1149+ (Malus baccata)
atgggtgccggtggaagaatggttgcgcctcctgtgcgcaaaaatgcgga tgctgacacccacaagagagttccgtactctaagcctccgttcagcctcg gtgaggtcaagaaagccatcccacctcattgttttcagcgctctgttatc cgctccttctcctatgtcttttatgacctcaccattgcctctatccttta ctacattgcttccacctacattcagaatctgtctcaacctctatccttct tggcatggccgattttctggtacgttcagggctgtgttctcaccggtgtt tgggtcatagcacatgagtgcggtcaccatgctttcagtgattatcaatg gctggatgacactgttggtttgatcctccactcttgcctccttgtcccgt acttctcatggaagtatagccatcgccgccaccattccaacacagcttcc cttgagcgagatgaagtctttgtccccaagcagaagttcgaaattggatg gcatgccaaatatctcaacaatccgccaggcagattcctcacactcctca tccaactcactctaggctggcctttgtatcttgcgttcaatgtttctgga aggccctacaaaggatttgcttgccactttcatccgtatgggccaatcta ctctgatcgcgaacgattgcagatatttgtgtccgatgctggtgttcttg ctgtcgtctatgggctttaccgtcttgccgttgcaaaggggcttgcttgg gttatatgcttctacggaggtcctctaatggtggtgaatggatttttggt actgatcacgtacttgcagcacacccaccccgcattgccgcactatgatt cctctgaatgggactggtttaggggagctttggccaccgttgacagagac tacggaatcctgaacaaggttttccacaacatcacagacactcacgttgc gcaccatttgttctcaaccatgccgcactatcacgcaatggaggcgacca aggcaatcaagccgatattgggcgagtactatcagttcgacgggactccg gtttacaaggcaatgtttagagaggcgaaggagtgtatctacgtcgagcc cgatgagggtgccaagaaaggtgtcttctggtacaataaaaagctgtga
back to top

Coding sequence (CDS) from alignment at KC702671:1..1149+

>KC702671.1-FAD2.m1 ID=KC702671.1-FAD2.m1|Name=FAD2|organism=Malus baccata|type=CDS|length=1149bp|location=Sequence derived from alignment at KC702671:1..1149+ (Malus baccata)
back to top