MKK1, MKK1 (gene) Malus x domestica

Gene Overview
Name MKK1
Gene Symbol MKK1
Type gene
Organism Malus x domestica
Synonym mitogen-activated protein kinase kinase
MAPKK
Description NA
Comment MAPKK
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MKK1GU139793.1-MKK1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
mitogen-activated protein kinase kinaseMKKMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly GU139793.1-MKK1.m1 Chr15:17033001..17035658
chr15:15195236..15197895
chr15:16383109..16385768
GU139793.1

Sequence(s):
>GU139793.1-MKK1.m11065
atgaagaaaggaagcttaggatccaacctcaagctcactctccctcctcctgatgaagtttccatctctaagttcttgac
acaaagcggtacgttcatggatggggatctcctggttaatagagaaggggttcggatcgtttctcatagagaagttgaag
ttccaccacctattcaagcatcagacaaccagatgattttagccgatctcgacgcgattaaagttattggcaagggaaat
ggtggggttgtgcaactggttcagcacaaatggactcatcagttttttgcattaaaggtaattcagatgaacattgaaga
gtctatccgcaagcagattgcacaggagttgaagattgatcaatcgtcacaatgtccaaacattgttgtatgttaccagt
ccttctatgaaaatggtgccatttcaatcatcctagagtacatggatggtgggtctttggcagatcttctgaagaaggtc
aaaacaattccagagttttatcttgctgccatttgtaagcaggtgctgcagggtttgtgttaccttcatcatgaaaagca
catcatccatcgggacttcaaaccctctaatttgttaatcaatcataggggagaaattaagataacagactttggtgtga
gtgcaataaaggcaagcacgtccgaacaggcaaatacatttgttggcacatacaactatatgtcgccagagagaattgtc
ggtagcaattatagctacaaaagtgacatttggagcttggggttagtactgctggagtgtgcaacaggtcaattcccata
tacaccaccggatcaaagtgaagcatgggataacttttttgagcttatgagtgccattgttgaacaaccaccatcttgtg
caccttcggatcaattttctccagagttctgctcatttatttctgcatgtgtacagaaagatcctaaggatagattgtcg
gctcaggatctcctgagacaccctttcatcagcatgtacgatgacgtgcatattgacctttccccttacttcaccgaagc
aggatctccccttgcaacattttaa
back to top