F3H, JN870847.1-F3H.m1 (mRNA) Pyrus pyrifolia

Transcript Overview
Unique NameJN870847.1-F3H.m1
OrganismPyrus pyrifolia ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
F3HF3HPyrus pyrifoliagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JN870847.1-F3H.m1-cds1JN870847.1-F3H.m1-cds1Pyrus pyrifoliaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
F3HJN870847.1-F3H.p1Pyrus pyrifoliapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
JN870847 region JN870847:1..1536+ NCBI Rosaceae gene and mRNA sequences
scaffold00346 supercontig scaffold00346:135867..138723+ Pyrus communis Genome v1.0 Draft Assembly & Annotation
Property NameValue
Productflavonoid 3' hydroxylase
The following sequences are available for this feature:

mRNA sequence

>JN870847.1-F3H.m1 ID=JN870847.1-F3H.m1|Name=F3H|organism=Pyrus pyrifolia|type=mRNA|length=1536bp
back to top

protein sequence of F3H

>JN870847.1-F3H.p1 ID=JN870847.1-F3H.p1|Name=F3H|organism=Pyrus pyrifolia|type=polypeptide|length=511bp
back to top

mRNA from alignment at JN870847:1..1536+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JN870847.1-F3H.m1 ID=JN870847.1-F3H.m1|Name=F3H|organism=Pyrus pyrifolia|type=mRNA|length=1536bp|location=Sequence derived from alignment at JN870847:1..1536+ (Pyrus pyrifolia)
atgtttgttctcatattcttcaccgttgtcttggcctttttcttataccg gctcttcgcccccggcaggagccgccacggtctgcctcttccgccagggc cgaaaccctggcctgtcgtgggaaacttgccccacttaggccccgttccc catcactctctggcggcattggcccgtcagtatggaccccttatgcacct ccgcctggggttcgttgacgtggttgttgcagcctctgcttcggtggcgt cacagttcttgaagacccatgacgccaatttctccagcagaccacccaac tcgggcgccaagcatctcgcttacaactaccaggatttggtgttcgcgcc gtacggtccgcgatggcggatgttacggaagatcagctccgtccatttgt tctccggcaaggctctcgatgatcttaaacatgttcgccaggaggaagta ggtgtgctggcacatggattagcaagtgcagggtcaaagccagtgaactt agggcagctactgaacgtgtgcacagtcaacgccctagggcgggtgatgg tagggcggaggctcttcggagacggcagcgggggcgaagaccagaaggcc gacgagttcaaatccatggtggtggagatgatggtgttggctggcgtttt caacattggcgacttcatcccggccctcgagtggctggacttgcaggggg tggcgggaaagatgaagaagctgcacaagagattcgatgccttcttgacc gccattgttgaagaccacaagaggagcggcgaagggaagcacgtgggcat gctgacgacgttgctgtctctcaaggatgatgctgacgatgacggcgcca agctcacggacactgagattaaggctttgcttttgaacatgttcacagct ggcactgacacatcatcaagcactgtggaatgggccatagcagaactcct tcgccaccccaagattctagcccaactccaacaagagctggaccaagtag tgggtcgggatcgactcgtaaccgagtcagacctgcccaacttgacctac ctccaagcagtaatcaaggaaacctttcggctacacccgtcaaccccact ctccctacctcgcatggcgtcagagagttgcgaaatcaatgggttccaca tccccaagggtgccactcttttggtcaatgtatgggccatatctcgcgac ccggcccaatggtctaaaccactcgagtttagacccgaacgattcttgcc gggtggagagaagcccaatgtggacgtcaggggtaatgatttcgaggtga taccgtttggggcggggcggagaatatgcgccgggatgacccttgggctg cggatggtatctctaatgactgcgaccctggtccacggttttgattggac cttggctaatgggctcacccctgataaattgatcatggacgaggcttatg ggctcacactacaaagagccgcaccattaatggtgcacccacgtaatagg ctagcccctcatgcatacaatgcgtcatcaccttga
back to top

Coding sequence (CDS) from alignment at JN870847:1..1536+

>JN870847.1-F3H.m1 ID=JN870847.1-F3H.m1|Name=F3H|organism=Pyrus pyrifolia|type=CDS|length=1536bp|location=Sequence derived from alignment at JN870847:1..1536+ (Pyrus pyrifolia)
back to top