MYB10, MYB10 (gene) Pyrus pyrifolia

Gene Overview
Name MYB10
Gene Symbol MYB10
Type gene
Organism Pyrus pyrifolia
Synonym MYB10 protein
Description NA
Comment PyMYB10; R2R3MYB protein; anthocyanin biosynthesis regulator
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MYB10HM585181.1-MYB10.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
myb transcription factorMYBPyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HM585181.1-MYB10.m1 N/A HM585181.1

Sequence(s):
>HM585181.1-MYB10.m1735
atggagggatataacgttaacttgagtgtgagaaaaggtgcctggactcgagaggaagacaatcttctcaggcagtgcat
tgagattcatggagagggaaagtggaaccaggtttcatacaaagcaggcttaaacaggtgcaggaagagctgcagacaaa
gatggttaaactatctgaagccaaatatcaagagaggagactttaaagaggatgaagtagatcttatacttagacttcac
aagcttttgggaaacaggtggtcattgattgctagaagacttccaggaagaacagcgaatgatgtgaaaaattattggaa
cactcgattgcggatcgattctcgcatgaaaacgttgaaaaataaatctcaagaaacgagaaagaccaatgtgataagac
ctcagccccaaaaattcatcaaaagttcatattacttaagcagtaaagaaccaattctagaacatattcaatcagcagaa
gatttaagtacgccatcacaaacgtcgtcgccaacaaagaacggaaatgattggtgggagaccttgttagaaggcgagga
tacttttgaaagggctccatgtcccagcattgagttagaggaagaactcttcacaactttttggtttgatgatcgactgt
cggcaagatcatgtgccaattttcctgaagaaggacaaagtagaagtgaattctcctttagcatggacctttggaatcat
tcaaaagaagaatag
back to top