MYB12A, MYB12A (gene) Malus hybrid cultivar

Gene Overview
Name MYB12A
Gene Symbol MYB12A
Type gene
Organism Malus hybrid cultivar
Synonym MYB12a protein
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MYB12AKJ020112.1-MYB12A.m1Malus hybrid cultivarmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
myb transcription factorMYBMalus hybrid cultivargene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly KJ020112.1-MYB12A.m1 Chr11:619722..621007
Chr11:672396..673683
chr11:464349..465637
chr11:452197..453484
chr11:470453..471738
KJ020112.1

Sequence(s):
>KJ020112.1-MYB12A.m11095
atgaggaacccatcgtcttcgtcgaaagcagcagcagcagcaagtgctaagatgcaaacgacgataacagcgtcgtcctc
gtcgagcaaggcggctggggttgctggagggaccaagacgccgtgttgcgcaaaggtgggtttgaagagagggccttgga
ctcccgaagaggacgagctgctggcaaattacatcaagaaagaaggggagggacggtggcggacccttcccaagcgggct
gggttgctccgctgcggtaagagctgccgcctccgctggatgaactatctccgcccttctgtcaagcgcggccagatcgc
ccccgatgaagaagatctcatccttcgcctccatcgccttctgggcaatcggtggtctttgatagctgggaggattccag
gccgtacggacaatgagataaagaactactggaacacacacctgagcaagaagctgataagccaaggcatagatcccaga
acccacaagcctctcaattcagatcatcactctgctgctgatgatgctgacgtggacaacacaaacaaatcaactgctgt
tgcttcttcttccaaagccaatgatcggttctcaaaccctaaccctagtcccccttctgatcgtcttgtccataaagaag
gggatccaaataacagccgtaatgatggaaacatcgcaattgctgatcatgatctgggcactatagtccatggctttgca
aatatgatcacgtccatcaacaatcccgatgcttcttcttcggccgcggcaacgggtactttgagtttgaggagcaacaa
cagccacggtggagtactacttgggggaggaggaaatgaagaggacgacgtcttctcttcgtttctgaattcgttgatca
atgaggatccatttcctggacaacaccaattgcaacaagtactgcagaatgggaatgttagtgcacacgcagctgctgct
cgttccgagaaccttcctttgattactatgactagtactacggcgccatcaacatttggctgggagtctgctgtgctcat
gtcttctgctttcatccaaaatgatcaccagagcgttaatgatcaaacggagtag
back to top