MYB17, MYB17 (gene) Rosa rugosa

Gene Overview
Name MYB17
Gene Symbol MYB17
Type gene
Organism Rosa rugosa
Synonym putative MYB transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MYB17FR828550.1-MYB17.m1Rosa rugosamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
myb transcription factorMYBRosa rugosagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database FR828550.1-MYB17.m1 N/A FR828550.1

Sequence(s):
>FR828550.1-MYB17.m1819
atggtgagagctccgtgctgcgagaagatggggttgaagaaagggccgtggacgccggaggaggatcacgtactcgtctc
ttacattcagcagtacggccatggaaactggagggcgcttcccaaactggcagggttgttgaggtgtgggaagagttgca
ggctgcggtggacgaactacctgaggccggatatcaagagagggaattttagcagggaggaagaagaggccatcatcaac
ttgcatcaaatgttggggaatagatggtcagcaattgcagcaagattgccgggtcgcacagacaatgaaataaaaaacgt
ttggcacacccacttgaaaaagaagctcagcatcaagcagaattctaccacaccagaagcacaaggtcaggaatccgaac
ccgaacccgaacctgaaaatacttcatgttttgcaaaatccgaaagcttcgaatatgggccggtttccccacctcaatgt
actacgagtgctgatgacacctcctcattcaccaccagtgagaacaatacctgtagtgctaatatgggcatgaaagtaga
ctacgaaatgaatttaccccaagcggacgagagcttttggtcagaagtactatcagctgatcagaactgttccaacgaga
cggtgagttgcgattttgatcaggcaattggtgcagcagcagatccacaagtgaacgcaactgtggaagttcctgtcgat
tttgggtttagtggctcaaatatgtacgataactgcatggatttttggtacaacgttttcacaacagcaggggagatttc
agaattgctagagatttga
back to top