MYB4, MYB4 (gene) Malus hybrid cultivar

Gene Overview
Name MYB4
Gene Symbol MYB4
Type gene
Organism Malus hybrid cultivar
Synonym MYB4
Description NA
Comment McMYB4
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MYB4JX013493.1-MYB4.m1Malus hybrid cultivarmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
myb transcription factorMYBMalus hybrid cultivargene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JX013493.1-MYB4.m1 Chr03:37292132..37296193
chr3:33338363..33342365
chr3:33335811..33339871
chr3:39056152..39060154
JX013493.1

Sequence(s):
>JX013493.1-MYB4.m1993
atggggagggcgccgtgctgtgagaaagtcggtctcaagaagggaaggtggacggcggaggaggatgaaatcttactcaa
ttatatccaggccaatggggaaggctcctggaggtctttacccaagaatgcagggttgctgcggtgtggaaagagttgca
gactgagatggataaattatctgagagctgacttaaagaggggaaatatttcttctcaagaggaagatatcatcatcaaa
ttgcatgcttctttgggtaataggtggtctttgatagcgagtcaattaccaggaagaaccgacaatgaaataaagaacta
ctggaactctcacttgagcagaaaaattggcaccttcaggaggcctgccaccaccaccgtcattactactgaaattagca
ccagttccccaccagccggtgatgaagtttccgcagctatggaattaggccctcccaaaagaaggggcggcagaaccagt
cgctgggccatgaagaagaacaaaacctactctaccaccaaacccaaaggcctcaaggcccggctgaggcagagccacca
caaacacgataatattgctgctgctgctgctgatgatgatcgtctcaataatgcccacgaggcaattgccttgcctacta
aaagtaataataaaaacgtggacaccatgcaggacggttacgtgctactaatggaggtcccggaccagcagcaggaaact
agaggtggaggaatagcaatgccggcaacagtcattgatcatcagaaagaaactgatggcgaaaaactaattttaggacc
acatccacatggacatgacgacgatgatatgaatgaatatgtcggcattaatggagggttgttgggttttactgactact
tgatggacgacattaatgaggacgagatactggatccaaatggggttatggctttaagttcaagtgaaataacattcatc
aagatgctgatcattttcccggacgcgttatag
back to top