MYB53, MYB53 (gene) Malus x domestica

Gene Overview
Name MYB53
Gene Symbol MYB53
Type gene
Organism Malus x domestica
Synonym MYB transcription factor
Description NA
Comment MdMYB53
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MYB53GQ246163.1-MYB53.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
myb transcription factorMYBMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly GQ246163.1-MYB53.m1 Chr04:23596051..23597430
chr4:14870846..14872225
chr4:16836409..16837788
GQ246163.1

Sequence(s):
>GQ246163.1-MYB53.m1913
agattgaatggaaattccatctccttgtcctatctgcagaactccaattggttgtttgaagaaagcacgggagccgaatg
gactgtggaagagaacaagctatttgaaaatgctctcgctttatacgataaggatacacccgatcgatggctcagggtgg
cggctatgatccctggaaagactgttggagatgtgatcaaacagtacaaggaattagaagaagatgttagtgatatcgaa
gctgggcttatcccaattcctggttacaccagtaacaatttcacaatggagtgggttaacaatcagggctttgatggatt
ggagcagttttacagtgttggtggaaagcgaagctcctcgactaggcccgcagatcaggagaggaagaaaggggtgccat
ggacagaagaagagcacaggcaatttctgatgggccttaaaaagtatggaaaaggtgactggagaaacatctctcgaaat
tttgtgatcacaaggacgcccactcaggttgctagtcatgcacaaaaatactttatcaggcaactcacaggagggaagga
caagagaagatctagcatccatgacatcacaaccgccaatcttcctgatgtgaaacccgcctcaccagacagtacttcta
aaagcccaccatcatcggatctctcctcaaccctggtgcagcagccacaccagcaccagaagttggccagcgtgagcatt
gactggaaatcgcccgatgagggacagcaaatggttttcggttctgcaaatgggaacaacttcttgggaccgttttgtgg
gatgtcttcacatgtacctaagcttgaggagcaaaattttctgagtggcaatcttcatggatcgcagttgggacattaca
acgcctgttttgagatgcaatcaatgcgatatc
back to top