MYBF1, MYBF1 (gene) Prunus avium

Gene Overview
Name MYBF1
Gene Symbol MYBF1
Type gene
Organism Prunus avium
Synonym R2R3-MYB transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MYBF1GU938682.1-MYBF1Prunus aviumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MYBF1GU938682.1-MYBF1.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
myb transcription factorMYBPrunus aviumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU938682.1-MYBF1 N/A GU938682.1
mRNA parsed from NCBI nr database GU938682.1-MYBF1.m1 N/A GU938682.1

Sequence(s):
>GU938682.1-MYBF13057
atggggagggctccatgctgtgacaagattgggctgaagaaggggaggtggacagcagaggaggatcaaatcttaatcaa
ctatatccagaccaatggggaaggctcctggaggtcattacccaagaatgcaggtacatatatatctatctttcaaaaat
atttacacactagaacttgtggatgtggtggtggtgctactgaatctcagtcatccggaatcttgttttgttcttcttct
cacgccttacattggtcattcattggctaagcttataaattgcttttgtcatatgtatgtatatattacgatgacgagtt
acttactgtgattctgattgaagggttactgcggtgtggtaaaagttgcagactaagatggattaactatttgagagccg
acttgaagaggggaaatatatctgcccaagaggaagatatcatcatcaaattgcatgcttctctgggaaataggtgagtt
gactactagtctcctccacctccttaattacttaataatacttactaactacttattctttatgaagttatgataaattg
ataattttctcactcattaattaccaaataaataacaaccgcaaacactagaaccaaaaccaccagcaagttaataaatt
attaaatcaaatcaaatccaaggacaagtgaattggacggatcaactttttgaaaattatgtcaactttttttcttttcg
ttgcaggcagtgcagcttgctttccctttgctcttttgttttctatctgtccctgtcaagtaaataaatttgcttgtttt
attagttggaactctggaaggaactaggtcacccttccctttttaaagaaaaaacacaaggaactagatcaccgtcaatg
ggtgagccaaggcactgatttgattgctttttacactttgagggagacactcggtagtcggtatatagaactgatcacgt
gtaatctttttccccatgaaaacaaacatagtttagtcagacttaaaaaaaataaaaaatacttgttatcagatttaata
cagaaattaattcctagtttcttatgactcatcaatactgtttagccagctagattttttgggtcaaaattagccagcta
gattggtcagtgcccaagtaagtattacgtgttcttgtcttttcgctacaactaagacttaaatatcagcagtttaatta
tgacaaaaaaaaaattagagatatttagtcatatactaaaatgtattaaaattataaataaactctacactatttaattt
ctataaacaaactcaaaaaaaatccaaaatatgatagctgaccctattgaatttaattttgattattaaattactttaat
gccctatttagtattttgggtttttttatgaggttttggggttgggtttgttttaagaaatcaatgacagttttgtaatt
taaaagaagttaaaagcctttttgttatgttataaatggcatttgggtgtgtttctaaaatccattttatataagttttt
tttaaaaaaaaataaaatttgggctcctatattaggtataatagtaaatctcccaaaaaaaaaaaaaaaaaaatatcagc
agtttaatgactccctccgagtatagaaatgaagttccatcagtagtgcagtggttgtgtggtagaagcgtagtagatgt
ttaattaatggattaaagtgataaatatgattatgcaggtggtctttgatagcaagtcaattaccaggaagaaccgataa
tgaaatcaagaactactggaactctcatttgagtaggaaaattgacaccttcagaaggcctactactactagtagtgatc
aaatgagtagcctaccagcagctgctagtaataatattcctttcaagcgaagaggcggtagaaccagtcgctgggccatg
aagaagagcaaaacatacaccactactactactactaattatacccaacgtcacaacaagggacagaaggacattactaa
tactgctgctgctgctgaggaggcgattgccctggagaagaagacgccctttcctgggcctaatgataatattgatacta
tgcaccacgattacatggtattaatgactgacccagctgctgatgaccatgatcatcatcctcatcacatggacgactgc
atggtcgacaaccttgttaatcatgatcatcatcagcagcagaaggaagcagaaggactagcaatgccagcggtcctcat
gagctctactactactactactactgagaatgaggaggaggaggatgaggtagaggtggaggaaaaggatactcgtgatc
atgatgggctgggtcctgtcaatattgatcaccgtcagaaggaaagtcacgaaatgcttttaggaccacatccacataac
gacgagaacaaggacgatgacttggatgaatctggcggcattgaatttgatggtgggttgttgggtacatttaatgaatt
gatggacaatgttgagttactgcagaaggatccaaattcaaatggggttttgactttaagtgatcatcaacatgatcatg
ccatgggcgttaatcatgaggtagatcaggtagagactgctactactacttgtggtcatttgagctcgtcatcaaacgga
caagtatgctcttcttcaataatgtcaatgactgctacttcaagtagttcagcttcagcttcagcagctgctggtaatta
ttattttgatatggaggatggtcaagctgctgctgctgcaaatggaaatgatcgtgatcataacaatcatatattatggg
attgggagagtgttgtcgaagcaggacatgagttatgggatcatgatgatgataaagcaaatatgctttcttggttgtgg
gaggagggtacttcttcttcttcttctactactagtaatactgctgctgctgcttctaccattcatcatcatcatcttaa
ctgggaaagagacactaccactgatgatacatcgattatgagagaggccgtggaccctgacaaacaaaatgcgatggtgg
cttggcttctgtcttga
back to top
>GU938682.1-MYBF1.m11602
atggggagggctccatgctgtgacaagattgggctgaagaaggggaggtggacagcagaggaggatcaaatcttaatcaa
ctatatccagaccaatggggaaggctcctggaggtcattacccaagaatgcagggttactgcggtgtggtaaaagttgca
gactaagatggattaactatttgagagccgacttgaagaggggaaatatatctgcccaagaggaagatatcatcatcaaa
ttgcatgcttctctgggaaataggtggtctttgatagcaagtcaattaccaggaagaaccgataatgaaatcaagaacta
ctggaactctcatttgagtaggaaaattgacaccttcagaaggcctactactactagtagtgatcaaatgagtagcctac
cagcagctgctagtaataatattcctttcaagcgaagaggcggtagaaccagtcgctgggccatgaagaagagcaaaaca
tacaccactactactactactaattatacccaacgtcacaacaagggacagaaggacattactaatactgctgctgctgc
tgaggaggcgattgccctggagaagaagacgccctttcctgggcctaatgataatattgatactatgcaccacgattaca
tggtattaatgactgacccagctgctgatgaccatgatcatcatcctcatcacatggacgactgcatggtcgacaacctt
gttaatcatgatcatcatcagcagcagaaggaagcagaaggactagcaatgccagcggtcctcatgagctctactactac
tactactactgagaatgaggaggaggaggatgaggtagaggtggaggaaaaggatactcgtgatcatgatgggctgggtc
ctgtcaatattgatcaccgtcagaaggaaagtcacgaaatgcttttaggaccacatccacataacgacgagaacaaggac
gatgacttggatgaatctggcggcattgaatttgatggtgggttgttgggtacatttaatgaattgatggacaatgttga
gttactgcagaaggatccaaattcaaatggggttttgactttaagtgatcatcaacatgatcatgccatgggcgttaatc
atgaggtagatcaggtagagactgctactactacttgtggtcatttgagctcgtcatcaaacggacaagtatgctcttct
tcaataatgtcaatgactgctacttcaagtagttcagcttcagcttcagcagctgctggtaattattattttgatatgga
ggatggtcaagctgctgctgctgcaaatggaaatgatcgtgatcataacaatcatatattatgggattgggagagtgttg
tcgaagcaggacatgagttatgggatcatgatgatgataaagcaaatatgctttcttggttgtgggaggagggtacttct
tcttcttcttctactactagtaatactgctgctgctgcttctaccattcatcatcatcatcttaactgggaaagagacac
taccactgatgatacatcgattatgagagaggccgtggaccctgacaaacaaaatgcgatggtggcttggcttctgtctt
ga
back to top