MYB, MYB (gene) Mespilus germanica

Gene Overview
Name MYB
Gene Symbol MYB
Type gene
Organism Mespilus germanica
Synonym R2R3 MYB transcription factor 10
Description NA
Comment MgMYB10
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MYBEU153574.1-MYB.m1Mespilus germanicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
myb transcription factorMYBMespilus germanicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EU153574.1-MYB.m1 N/A EU153574.1

Sequence(s):
>EU153574.1-MYB.m1738
atggagggatataacgttaacttgagtgtgagaaaaggtgcctggactcgagaggaagacaatcttctcaggcagtgcat
tgagattcatggagagggaaagtggaaccaagtttcatacaaagcaggcttaaacaggtgcaggaagagctgcagactaa
gatggttaaactacctgaagccaagtatcaagagaggggactttaaagaggatgaagtagatcttataattagacttcac
aagcttttaggaaacaggtggtcattgattgctcaaagacttccaggaaggactgcgaatgatgtgaaaaattactggaa
cacccgattgcggatggattattccctgaaaaagatgaaaaataaatctcaagaaacaagaaagaccaatgtgataagac
ctcaggcccaaaaattcatcaaaagttcatattacttgagcagtaaagaaccaattctggaccatattcaatcagcagaa
gatttaagtacgccaccacaaacgtcgtcaacaaagaatggaaatgattggtgggagaccttgttagaagtcgatgatac
ttttgaaagagctgcatgtcccagccttgagttagaggaagaagtcttcccaagtttttgggttgatgatatgcgactgt
cggcaagatcatgtgccaattttcctgaagaaggacaaagtagaagtgaattatcctttagcacggacctttggaatcat
tcaaagaagaatagctag
back to top