C4H, KF663548.1-C4H.m1 (mRNA) Pyrus x bretschneideri

Transcript Overview
Unique NameKF663548.1-C4H.m1
OrganismPyrus x bretschneideri ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
C4HC4HPyrus x bretschneiderigene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KF663548.1-C4H.m1-cds1KF663548.1-C4H.m1-cds1Pyrus x bretschneideriCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
C4HKF663548.1-C4H.p1Pyrus x bretschneideripolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KF663548 region KF663548:86..1600+ NCBI Rosaceae gene and mRNA sequences
scaffold00442 supercontig scaffold00442:28348..32677+ Pyrus communis Genome v1.0 Draft Assembly & Annotation
Property NameValue
Productcinnamate 4-hydroxylase
Genbank noteC4H
The following sequences are available for this feature:

mRNA sequence

>KF663548.1-C4H.m1 ID=KF663548.1-C4H.m1|Name=C4H|organism=Pyrus x bretschneideri|type=mRNA|length=1515bp
back to top

protein sequence of C4H

>KF663548.1-C4H.p1 ID=KF663548.1-C4H.p1|Name=C4H|organism=Pyrus x bretschneideri|type=polypeptide|length=504bp
back to top

mRNA from alignment at KF663548:86..1600+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KF663548.1-C4H.m1 ID=KF663548.1-C4H.m1|Name=C4H|organism=Pyrus x bretschneideri|type=mRNA|length=1515bp|location=Sequence derived from alignment at KF663548:86..1600+ (Pyrus x bretschneideri)
atggacctcctcctcctggaaaagacccttctgggtctcttcgtcgcggt catcgttgccatcaccatttcaaaactccgcggcaagaaattcaggctcc cgccgggtcccatccccgtacccgtattcggaaactggctccaggtcggt gacgacctcaaccaccgcaatctcaccgacatggccaagaaattcggcga ctgcttcctcctccgcatggggcagcgcaacctcgtcgttgtctcctcgc cggagctcgccaaggaggtcctccacactcagggagtcgaattcgggtcg aggacccgaaacgtcgtctttgatattttcaccggtgaaggccaggacat ggtgttcaccgtctacggcgagcactggcggaaaatgcggcgtatcatga ccgtccccttcttcaccaacaaggttgtccagcagtaccgctacggatgg gagtcggaggcggcggcggtcgtcgaggatgtgaaaaagcatcccgaggc ggcgaccagcggaatggtgctgcggaggcggctgcagctgatgatgtaca acaacatgtacagaatcatgttcgaccggcgattcgagagcgaggaggat cccctgttcgtgaagctcaaggcgctgaatggggagaggagccgattggc gcagagcttcgactacaactacggcgattttatcccgatcttaaggccct ttttgagagggtatttgaagatctgcaaggaagtgaaggagaagaggatc cagctgtttaaggactatttcgtggacgagaggaagaaactttcgagcac aaagccgacaacaaacgaagggttgaaatgcgccatcgaccacatcctcg acgcgcagcagaaaggagaaatcaacgaggacaacgttctctacatcgtc gagaacatcaacgttgctgctattgaaaccacattgtggtcgatcgagtg gggaattgccgagctagtgaaccatcccgaaatccagaagaagctgagga atgaactcgacacagtccttggccgcggagttcagatcacagagcccgac gttcataaacttccctacctgcaagccgtggtcaaggagactctccgact tcgcatggcaatcccactccttgtcccccacatgaacctccaggatgcca agctcggtgggtttgatattccggcggagagcaagatactggtgaatgct tggtggttggcaaacaaccctgccctgtggaagaagccagaagagtttag gcctgagaggtttttggaggaggagtcgaaggtggaggctaacgggaacg acttcaggtatctcccgtttggtgttgggaggagaagttgtcctgggatt attttggccctgccaatcctgggcattacaattggacgtttagttcagaa cttcgagcttctgcctccgccaggacagtccaagctcgacacctcggaga aaggtggacagttcagcctgcacatcctgaagcactccaccattgtgatg aagccgatggcgtag
back to top

Coding sequence (CDS) from alignment at KF663548:86..1600+

>KF663548.1-C4H.m1 ID=KF663548.1-C4H.m1|Name=C4H|organism=Pyrus x bretschneideri|type=CDS|length=1515bp|location=Sequence derived from alignment at KF663548:86..1600+ (Pyrus x bretschneideri)
back to top