COI1, KF434755.1-COI1.m1 (mRNA) Pyrus pyrifolia

Transcript Overview
Unique NameKF434755.1-COI1.m1
OrganismPyrus pyrifolia ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
COI1COI1Pyrus pyrifoliagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KF434755.1-COI1.m1-cds1KF434755.1-COI1.m1-cds1Pyrus pyrifoliaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
COI1KF434755.1-COI1.p1Pyrus pyrifoliapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KF434755 region KF434755:1..531+ NCBI Rosaceae gene and mRNA sequences
scaffold00175 supercontig scaffold00175:161977..162507+ Pyrus communis Genome v1.0 Draft Assembly & Annotation
Property NameValue
Productcoronatine insensitive 1
The following sequences are available for this feature:

mRNA sequence

>KF434755.1-COI1.m1 ID=KF434755.1-COI1.m1|Name=COI1|organism=Pyrus pyrifolia|type=mRNA|length=531bp
back to top

protein sequence of COI1

>KF434755.1-COI1.p1 ID=KF434755.1-COI1.p1|Name=COI1|organism=Pyrus pyrifolia|type=polypeptide|length=176bp
back to top

mRNA from alignment at KF434755:1..531+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KF434755.1-COI1.m1 ID=KF434755.1-COI1.m1|Name=COI1|organism=Pyrus pyrifolia|type=mRNA|length=531bp|location=Sequence derived from alignment at KF434755:1..531+ (Pyrus pyrifolia)
gagacaataacagatttgccacttgacaatggggttcgagctcttttgag gggatgccagaagcttcgtaggtttgctctgtatctccgtcgtgggggct tgactgatctgggactgagttatatcggccagtacagtcagaatgtgaga tggatgcttctgggttatgttggggaatctgatgcagggcttttggcttt ctcaaagggttgccctagcctgcaaaaattggaaatgaggggttgctgct tcagcgagcgtgcactcgctgatgctgtaatgcaactgacttcccttagg tacttgtgggtgcaggggtacagaggatctggaactggtcgcgacctttt ggcaatggctcgcccattttggaatatcgagttgattcctccgagacgag ttgatgttcctgatcagcagggagtcgagcatccagcccatatacttgca tactactcacttgctggaccgagaacagattttccagacagtgttattcc cgttgatccggcatccttgctctccttctag
back to top

Coding sequence (CDS) from alignment at KF434755:1..531+

>KF434755.1-COI1.m1 ID=KF434755.1-COI1.m1|Name=COI1|organism=Pyrus pyrifolia|type=CDS|length=531bp|location=Sequence derived from alignment at KF434755:1..531+ (Pyrus pyrifolia)
back to top