F3H, JF740092.1-F3H.m1 (mRNA) Prunus avium

Transcript Overview
Unique NameJF740092.1-F3H.m1
OrganismPrunus avium ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
F3HF3HPrunus aviumgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JF740092.1-F3H.m1-cds1JF740092.1-F3H.m1-cds1Prunus aviumCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
F3HJF740092.1-F3H.p1Prunus aviumpolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
JF740092 region JF740092:1..1083+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productflavanone 3-hydroxylase
The following sequences are available for this feature:

mRNA sequence

>JF740092.1-F3H.m1 ID=JF740092.1-F3H.m1|Name=F3H|organism=Prunus avium|type=mRNA|length=1083bp
back to top

protein sequence of F3H

>JF740092.1-F3H.p1 ID=JF740092.1-F3H.p1|Name=F3H|organism=Prunus avium|type=polypeptide|length=360bp
back to top

mRNA from alignment at JF740092:1..1083+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JF740092.1-F3H.m1 ID=JF740092.1-F3H.m1|Name=F3H|organism=Prunus avium|type=mRNA|length=1083bp|location=Sequence derived from alignment at JF740092:1..1083+ (Prunus avium)
atggctcctgctactactctcacctccattgcaggggagaaaaccctgca acaaaaatttgtccgggacgaagatgagcgccccaaggttgcctacaaca acttcagcaatgaaatcccgatcatttcgcttgccgggatcgacgaggaa ggccgccgggccgagatttgcaagaagattgtggaggcttgtgaggattg gggtatttaccagattgttgatcatggagttgatgccaagctcatctctg aaatgaccggtctcgccagagagttcttcgctttgccgtccgaggagaag cttcgctttgacatgtccggcggcaaaaagggtggtttcatcgtctccag ccatttacagggagaagccgtgcaagattggcgcgaaattgtgacatact tctcatacccaatccggcaccgggactattcgaggtggccggacaagcca gagggatggagagaggtgacacagaagtacagcgacgagctgatggggct ggcatgcaagcttttgggggtgttatcagaagccatgggattggatacag aggcattgacaaaggcgtgtgtagacatggaccaaaaagttgtggtcaat ttctacccaaaatgcccccaacccgacctcacccttggcctgaagcgcca cactgacccaggcacaattacccttttgctccaagaccaggttggtggcc tccaggctacaagggatggtgggaagacgtggatcaccgttcaaccagtg gaaggagccttcgtggtcgatcttggagaccatggtcatcttctgagcaa tgggaggttcaagaatgctgatcaccaagcagttgtgaactcaaacagca gcaggctgtccatagccacattccagaacccagcccaagaagctatagtc tacccactgagcatcagagagggagagaagcccattctagaggggccaat cacctacacagagatgtacaagaagaagatgggcagggaccttgagcttg ccaggctaaaaaagctggccaaggagcaacaatcgcaggacttgaagaag gagaccaagtcagccgatgatatttttgcttag
back to top

Coding sequence (CDS) from alignment at JF740092:1..1083+

>JF740092.1-F3H.m1 ID=JF740092.1-F3H.m1|Name=F3H|organism=Prunus avium|type=CDS|length=1083bp|location=Sequence derived from alignment at JF740092:1..1083+ (Prunus avium)
back to top